SZGR2

Summary ?

GeneID	23322
Symbol	RPGRIP1L
Synonyms	CORS3\|FTM\|JBTS7\|MKS5\|NPHP8\|PPP1R134
Description	RPGRIP1-like
Reference	MIM:610937\|HGNC:HGNC:29168\|Ensembl:ENSG00000103494\|HPRD:17204\|Vega:OTTHUMG00000173125
Gene type	protein-coding
Map location	16q12.2
Pascal p-value	0.002
Fetal beta	0.068
eGene	Cortex

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 4

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TSN	0.92	0.90
ARMC1	0.91	0.91
VPS37A	0.90	0.89
UBA2	0.90	0.93
ELP3	0.90	0.87
KPNA4	0.89	0.89
SMU1	0.89	0.87
CNOT7	0.89	0.88
RBM18	0.89	0.89
MAPKSP1	0.89	0.87

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MT-CO2	-0.75	-0.75
AF347015.8	-0.73	-0.75
MT-CYB	-0.72	-0.74
AF347015.33	-0.71	-0.72
AF347015.31	-0.71	-0.73
AF347015.21	-0.70	-0.72
AF347015.26	-0.70	-0.72
AF347015.2	-0.69	-0.70
AF347015.15	-0.69	-0.73
AF347015.27	-0.68	-0.71

Section III. Gene Ontology annotation

Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007420	brain development	IEA	Brain (GO term level: 7)	-
GO:0022038	corpus callosum development	IEA	axon (GO term level: 10)	-
GO:0021549	cerebellum development	IEA	Brain (GO term level: 10)	-
GO:0021772	olfactory bulb development	IEA	neuron (GO term level: 11)	-
GO:0001701	in utero embryonic development	IEA		-
GO:0001889	liver development	IEA		-
GO:0001822	kidney development	IEA		-
GO:0007368	determination of left/right symmetry	IEA		-
GO:0008589	regulation of smoothened signaling pathway	IEA		-
GO:0007382	specification of segmental identity, maxillary segment	IEA		-
GO:0021532	neural tube patterning	IEA		-
GO:0042305	specification of segmental identity, mandibular segment	IEA		-
GO:0042384	cilium biogenesis	IEA		-
GO:0021670	lateral ventricle development	IEA		-
GO:0043010	camera-type eye development	IEA		-
GO:0035108	limb morphogenesis	IEA		-
GO:0035115	embryonic forelimb morphogenesis	IEA		-
GO:0035116	embryonic hindlimb morphogenesis	IEA		-
GO:0043584	nose development	IEA		-
GO:0060039	pericardium development	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005813	centrosome	IDA		17558409
GO:0005737	cytoplasm	IDA		17558409
GO:0005932	basal body	IDA		17558409
GO:0005929	cilium	IDA		17558409
GO:0035085	cilium axoneme	IDA		17558409

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
ROYLANCE BREAST CANCER 16Q COPY NUMBER UP	63	44	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN	911	527	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN	1011	592	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 2	473	224	All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP	439	257	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-103/107	1008	1015	1A,m8	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	1008	1015	1A,m8	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-125/351	1166	1172	1A	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	1166	1172	1A	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-128	453	459	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	453	459	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-133	1540	1546	m8	hsa-miR-133a	UUGGUCCCCUUCAACCAGCUGU
miR-133	1540	1546	m8	hsa-miR-133b	UUGGUCCCCUUCAACCAGCUA
miR-136	991	997	m8	hsa-miR-136	ACUCCAUUUGUUUUGAUGAUGGA
miR-137	472	479	1A,m8	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-144	451	457	m8	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-185	1721	1727	1A	hsa-miR-185^brain	UGGAGAGAAAGGCAGUUC
miR-196	1193	1199	1A	hsa-miR-196a	UAGGUAGUUUCAUGUUGUUGG
miR-196	1193	1199	1A	hsa-miR-196b	UAGGUAGUUUCCUGUUGUUGG
miR-203.1	1049	1055	1A	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-203.1	1049	1055	1A	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-216	62	68	m8	hsa-miR-216	UAAUCUCAGCUGGCAACUGUG
miR-217	1853	1859	1A	hsa-miR-217	UACUGCAUCAGGAACUGAUUGGAU
miR-22	1398	1404	1A	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-27	998	1004	1A	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
				hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
				hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
				hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-28	1308	1314	1A	hsa-miR-28^brain	AAGGAGCUCACAGUCUAUUGAG
miR-323	498	504	m8	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-34/449	197	203	1A	hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC
miR-377	1275	1281	m8	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-381	150	156	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-409-3p	1321	1328	1A,m8	hsa-miR-409-3p	CGAAUGUUGCUCGGUGAACCCCU
miR-452	1125	1132	1A,m8	hsa-miR-452	UGUUUGCAGAGGAAACUGAGAC
miR-488	900	906	m8	hsa-miR-488	CCCAGAUAAUGGCACUCUCAA
miR-495	1748	1754	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-496	1155	1161	1A	hsa-miR-496	AUUACAUGGCCAAUCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: RPGRIP1L