Gene Page: CD2AP
Summary ?
GeneID | 23607 |
Symbol | CD2AP |
Synonyms | CMS |
Description | CD2-associated protein |
Reference | MIM:604241|HGNC:HGNC:14258|Ensembl:ENSG00000198087|HPRD:05026|Vega:OTTHUMG00000014799 |
Gene type | protein-coding |
Map location | 6p12 |
Pascal p-value | 0.416 |
Fetal beta | 1.339 |
DMG | 1 (# studies) |
eGene | Cerebellum |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg21434440 | 6 | 47446198 | CD2AP | 1.31E-8 | -0.024 | 5.25E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IPI | 12029088 |14679214 | |
GO:0005200 | structural constituent of cytoskeleton | TAS | 10339567 | |
GO:0017124 | SH3 domain binding | IDA | 10339567 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006461 | protein complex assembly | TAS | 10339567 | |
GO:0007165 | signal transduction | NAS | 10339567 | |
GO:0007049 | cell cycle | IEA | - | |
GO:0007067 | mitosis | IEA | - | |
GO:0006930 | substrate-bound cell migration, cell extension | TAS | 10339567 | |
GO:0051301 | cell division | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0001726 | ruffle | IDA | 10339567 | |
GO:0005730 | nucleolus | IDA | 18029348 | |
GO:0005737 | cytoplasm | TAS | 10339567 | |
GO:0005886 | plasma membrane | IDA | 18029348 | |
GO:0015629 | actin cytoskeleton | TAS | 10339567 | |
GO:0031941 | filamentous actin | IDA | 10339567 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
BCAR1 | CAS | CAS1 | CASS1 | CRKAS | P130Cas | breast cancer anti-estrogen resistance 1 | - | HPRD,BioGRID | 10339567 |
CAPZA1 | CAPPA1 | CAPZ | CAZ1 | capping protein (actin filament) muscle Z-line, alpha 1 | - | HPRD,BioGRID | 12690097 |
CASK | CAGH39 | CMG | FLJ22219 | FLJ31914 | LIN2 | MICPCH | TNRC8 | calcium/calmodulin-dependent serine protein kinase (MAGUK family) | Reconstituted Complex | BioGRID | 15331416 |
CBL | C-CBL | CBL2 | RNF55 | Cas-Br-M (murine) ecotropic retroviral transforming sequence | CMS interacts with Cbl. This interaction was modeled on a demonstrated interaction between CMS from an unspecified species and human Cbl. | BIND | 15128873 |
CBL | C-CBL | CBL2 | RNF55 | Cas-Br-M (murine) ecotropic retroviral transforming sequence | - | HPRD,BioGRID | 11067845 |
CD2 | SRBC | T11 | CD2 molecule | Reconstituted Complex | BioGRID | 12690097 |
CD2 | SRBC | T11 | CD2 molecule | - | HPRD | 9741631 |
CD2AP | CMS | DKFZp586H0519 | CD2-associated protein | - | HPRD,BioGRID | 10339567 |
CDH3 | CDHP | HJMD | PCAD | cadherin 3, type 1, P-cadherin (placental) | Affinity Capture-Western | BioGRID | 15331416 |
FYN | MGC45350 | SLK | SYN | FYN oncogene related to SRC, FGR, YES | - | HPRD | 10339567 |
GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | - | HPRD | 10339567 |
NPHS1 | CNF | NPHN | nephrosis 1, congenital, Finnish type (nephrin) | - | HPRD,BioGRID | 10997929 |
NPHS2 | PDCN | SRN1 | nephrosis 2, idiopathic, steroid-resistant (podocin) | - | HPRD,BioGRID | 11733557 |
PIK3R1 | GRB1 | p85 | p85-ALPHA | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | - | HPRD | 10339567 |
PKD2 | APKD2 | MGC138466 | MGC138468 | PC2 | PKD4 | polycystic kidney disease 2 (autosomal dominant) | - | HPRD | 10913159 |
PTK2B | CADTK | CAKB | FADK2 | FAK2 | FRNK | PKB | PTK | PYK2 | RAFTK | PTK2B protein tyrosine kinase 2 beta | Affinity Capture-Western | BioGRID | 15128873 |
RAB4A | HRES-1/RAB4 | RAB4 | RAB4A, member RAS oncogene family | - | HPRD,BioGRID | 12559036 |
SRC | ASV | SRC1 | c-SRC | p60-Src | v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) | - | HPRD | 10339567 |
YES1 | HsT441 | P61-YES | Yes | c-yes | v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 | - | HPRD | 10339567 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID NEPHRIN NEPH1 PATHWAY | 31 | 24 | All SZGR 2.0 genes in this pathway |
PID VEGFR1 PATHWAY | 26 | 23 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CELL COMMUNICATION | 120 | 77 | All SZGR 2.0 genes in this pathway |
REACTOME NEPHRIN INTERACTIONS | 20 | 15 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN | 463 | 290 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
BOGNI TREATMENT RELATED MYELOID LEUKEMIA DN | 33 | 19 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA PROGRESSION RISK | 74 | 44 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
OXFORD RALA OR RALB TARGETS DN | 24 | 17 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA2 PCC NETWORK | 423 | 265 | All SZGR 2.0 genes in this pathway |
PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 1 UP | 182 | 119 | All SZGR 2.0 genes in this pathway |
GENTILE UV RESPONSE CLUSTER D9 | 28 | 15 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP | 314 | 201 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 48HR UP | 180 | 125 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR UP | 178 | 111 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS DN | 314 | 188 | All SZGR 2.0 genes in this pathway |
DE YY1 TARGETS DN | 92 | 64 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL DN | 216 | 143 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER SURVIVAL DN | 175 | 103 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO CSF2RB AND IL4 DN | 315 | 201 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF UP | 418 | 282 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP | 408 | 276 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH 11Q23 REARRANGED | 351 | 238 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
KARLSSON TGFB1 TARGETS DN | 207 | 139 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA MESENCHYMAL | 216 | 130 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS DN | 553 | 343 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 2784 | 2791 | 1A,m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-128 | 2486 | 2492 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-137 | 2642 | 2648 | 1A | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
miR-15/16/195/424/497 | 2698 | 2705 | 1A,m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-181 | 2290 | 2297 | 1A,m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-182 | 2275 | 2282 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA | ||||
miR-219 | 2584 | 2591 | 1A,m8 | hsa-miR-219brain | UGAUUGUCCAAACGCAAUUCU |
miR-221/222 | 2639 | 2645 | 1A | hsa-miR-221brain | AGCUACAUUGUCUGCUGGGUUUC |
hsa-miR-222brain | AGCUACAUCUGGCUACUGGGUCUC | ||||
miR-25/32/92/363/367 | 2659 | 2665 | m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-26 | 2560 | 2566 | 1A | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-27 | 2486 | 2492 | m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-369-3p | 308 | 314 | m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-409-3p | 2783 | 2789 | m8 | hsa-miR-409-3p | CGAAUGUUGCUCGGUGAACCCCU |
miR-410 | 156 | 162 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
miR-452 | 222 | 229 | 1A,m8 | hsa-miR-452 | UGUUUGCAGAGGAAACUGAGAC |
miR-485-3p | 2568 | 2574 | m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
miR-503 | 2699 | 2705 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
miR-96 | 2276 | 2282 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.