Gene Page: GLP1R
Summary ?
| GeneID | 2740 |
| Symbol | GLP1R |
| Synonyms | - |
| Description | glucagon like peptide 1 receptor |
| Reference | MIM:138032|HGNC:HGNC:4324|Ensembl:ENSG00000112164|HPRD:00677|Vega:OTTHUMG00000014638 |
| Gene type | protein-coding |
| Map location | 6p21 |
| Pascal p-value | 0.273 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.033 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0024 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004930 | G-protein coupled receptor activity | IEA | - | |
| GO:0004967 | glucagon receptor activity | IEA | - | |
| GO:0008528 | peptide receptor activity, G-protein coupled | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007204 | elevation of cytosolic calcium ion concentration | IDA | 7589461 | |
| GO:0007190 | activation of adenylate cyclase activity | TAS | 8405712 | |
| GO:0007186 | G-protein coupled receptor protein signaling pathway | IEA | - | |
| GO:0006950 | response to stress | IEA | - | |
| GO:0007165 | signal transduction | IEA | - | |
| GO:0008016 | regulation of heart contraction | IEA | - | |
| GO:0007611 | learning or memory | IEA | - | |
| GO:0019933 | cAMP-mediated signaling | IDA | 7589461 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016021 | integral to membrane | TAS | 8405712 | |
| GO:0005886 | plasma membrane | TAS | 8405712 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION | 272 | 195 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
| REACTOME INTEGRATION OF ENERGY METABOLISM | 120 | 84 | All SZGR 2.0 genes in this pathway |
| REACTOME REGULATION OF INSULIN SECRETION BY GLUCAGON LIKE PEPTIDE1 | 43 | 28 | All SZGR 2.0 genes in this pathway |
| REACTOME REGULATION OF INSULIN SECRETION | 93 | 65 | All SZGR 2.0 genes in this pathway |
| REACTOME CLASS B 2 SECRETIN FAMILY RECEPTORS | 88 | 58 | All SZGR 2.0 genes in this pathway |
| REACTOME GLUCAGON TYPE LIGAND RECEPTORS | 33 | 22 | All SZGR 2.0 genes in this pathway |
| REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
| REACTOME G ALPHA S SIGNALLING EVENTS | 121 | 82 | All SZGR 2.0 genes in this pathway |
| REACTOME GPCR LIGAND BINDING | 408 | 246 | All SZGR 2.0 genes in this pathway |
| LIU SOX4 TARGETS UP | 137 | 94 | All SZGR 2.0 genes in this pathway |
| GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
| GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN | 335 | 193 | All SZGR 2.0 genes in this pathway |
| WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
| SHEN SMARCA2 TARGETS DN | 357 | 212 | All SZGR 2.0 genes in this pathway |
| RADAEVA RESPONSE TO IFNA1 DN | 10 | 5 | All SZGR 2.0 genes in this pathway |
| MOREAUX MULTIPLE MYELOMA BY TACI UP | 412 | 249 | All SZGR 2.0 genes in this pathway |
| KONDO EZH2 TARGETS | 245 | 148 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K27ME3 | 269 | 159 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
| SERVITJA ISLET HNF1A TARGETS DN | 109 | 71 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-150 | 58 | 64 | 1A | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
| miR-324-3p | 176 | 182 | m8 | hsa-miR-324-3p | CCACUGCCCCAGGUGCUGCUGG |
| miR-505 | 643 | 649 | m8 | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.