Gene Page: GOLGA4
Summary ?
| GeneID | 2803 |
| Symbol | GOLGA4 |
| Synonyms | CRPF46|GCP2|GOLG|MU-RMS-40.18|p230 |
| Description | golgin A4 |
| Reference | MIM:602509|HGNC:HGNC:4427|Ensembl:ENSG00000144674|HPRD:03941|Vega:OTTHUMG00000130799 |
| Gene type | protein-coding |
| Map location | 3p22-p21.3 |
| Pascal p-value | 0.009 |
| Sherlock p-value | 0.487 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.006 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AC011308.1 | 0.93 | 0.93 |
| IPO7 | 0.90 | 0.92 |
| FYTTD1 | 0.90 | 0.92 |
| STAM2 | 0.90 | 0.92 |
| SPIN1 | 0.90 | 0.93 |
| KPNA3 | 0.90 | 0.92 |
| FAM172A | 0.89 | 0.93 |
| KLHDC10 | 0.89 | 0.91 |
| OSBPL8 | 0.89 | 0.93 |
| AZIN1 | 0.89 | 0.91 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AC018755.7 | -0.70 | -0.74 |
| FXYD1 | -0.68 | -0.76 |
| MT-CO2 | -0.67 | -0.76 |
| IFI27 | -0.65 | -0.74 |
| HIGD1B | -0.65 | -0.76 |
| AF347015.33 | -0.65 | -0.73 |
| HSD17B14 | -0.65 | -0.70 |
| AF347015.31 | -0.65 | -0.73 |
| S100B | -0.64 | -0.71 |
| AC021016.1 | -0.64 | -0.71 |
Section III. Gene Ontology annotation
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016192 | vesicle-mediated transport | TAS | 8626529 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000139 | Golgi membrane | IEA | - | |
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0005802 | trans-Golgi network | TAS | 1400343 | |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| WATANABE RECTAL CANCER RADIOTHERAPY RESPONSIVE UP | 108 | 67 | All SZGR 2.0 genes in this pathway |
| ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
| THUM SYSTOLIC HEART FAILURE DN | 244 | 147 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
| HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
| LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
| WOOD EBV EBNA1 TARGETS DN | 47 | 33 | All SZGR 2.0 genes in this pathway |
| GRUETZMANN PANCREATIC CANCER DN | 203 | 134 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
| BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
| ONDER CDH1 TARGETS 1 UP | 140 | 85 | All SZGR 2.0 genes in this pathway |
| IIZUKA LIVER CANCER PROGRESSION G1 G2 DN | 25 | 18 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE INCIPIENT UP | 390 | 242 | All SZGR 2.0 genes in this pathway |
| MCCLUNG COCAINE REWARD 5D | 79 | 62 | All SZGR 2.0 genes in this pathway |
| ULE SPLICING VIA NOVA2 | 43 | 38 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| YAMAZAKI TCEB3 TARGETS DN | 215 | 132 | All SZGR 2.0 genes in this pathway |
| BANDRES RESPONSE TO CARMUSTIN MGMT 48HR UP | 18 | 13 | All SZGR 2.0 genes in this pathway |
| KYNG DNA DAMAGE DN | 195 | 135 | All SZGR 2.0 genes in this pathway |
| KYNG ENVIRONMENTAL STRESS RESPONSE UP | 56 | 41 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
| BLUM RESPONSE TO SALIRASIB UP | 245 | 159 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA CHEMOTAXIS UP | 74 | 45 | All SZGR 2.0 genes in this pathway |
| DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
| GABRIELY MIR21 TARGETS | 289 | 187 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| IKEDA MIR30 TARGETS UP | 116 | 87 | All SZGR 2.0 genes in this pathway |
| PLASARI TGFB1 SIGNALING VIA NFIC 1HR DN | 106 | 77 | All SZGR 2.0 genes in this pathway |
| KRIEG KDM3A TARGETS NOT HYPOXIA | 208 | 107 | All SZGR 2.0 genes in this pathway |
| BOSCO INTERFERON INDUCED ANTIVIRAL MODULE | 78 | 48 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-101 | 596 | 602 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
| miR-144 | 596 | 602 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
| miR-25/32/92/363/367 | 397 | 404 | 1A,m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
| hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
| hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
| hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
| hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
| miR-30-5p | 551 | 557 | m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
| hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
| hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
| hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
| hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
| miR-361 | 434 | 441 | 1A,m8 | hsa-miR-361brain | UUAUCAGAAUCUCCAGGGGUAC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.