Gene Page: PGP
Summary ?
GeneID | 283871 |
Symbol | PGP |
Synonyms | PGPase |
Description | phosphoglycolate phosphatase |
Reference | MIM:172280|HGNC:HGNC:8909|Ensembl:ENSG00000184207|Vega:OTTHUMG00000177047 |
Gene type | protein-coding |
Map location | 16p13.3 |
Pascal p-value | 0.744 |
Fetal beta | -1.611 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0016787 | hydrolase activity | IEA | - | |
GO:0008967 | phosphoglycolate phosphatase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0001501 | skeletal system development | IEA | - | |
GO:0005975 | carbohydrate metabolic process | IEA | - | |
GO:0008152 | metabolic process | IEA | - | |
GO:0016331 | morphogenesis of embryonic epithelium | IEA | - | |
GO:0042981 | regulation of apoptosis | IEA | - | |
GO:0030155 | regulation of cell adhesion | IEA | - | |
GO:0042475 | odontogenesis of dentine-containing tooth | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG GLYOXYLATE AND DICARBOXYLATE METABOLISM | 16 | 12 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP | 285 | 181 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
PASQUALUCCI LYMPHOMA BY GC STAGE DN | 165 | 104 | All SZGR 2.0 genes in this pathway |
SHEPARD BMYB MORPHOLINO UP | 205 | 126 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS LATE PROGENITOR | 544 | 307 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS PEAK AT 16HR | 40 | 24 | All SZGR 2.0 genes in this pathway |
CHANDRAN METASTASIS UP | 221 | 135 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-125/351 | 363 | 369 | 1A | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
miR-137 | 1423 | 1429 | 1A | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
miR-17-5p/20/93.mr/106/519.d | 201 | 207 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-30-5p | 174 | 181 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-409-5p | 290 | 297 | 1A,m8 | hsa-miR-409-5p | AGGUUACCCGAGCAACUUUGCA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.