SZGR2

Summary ?

GeneID	3064
Symbol	HTT
Synonyms	HD\|IT15
Description	huntingtin
Reference	MIM:613004\|HGNC:HGNC:4851\|Ensembl:ENSG00000197386\|HPRD:00883\|Vega:OTTHUMG00000159916
Gene type	protein-coding
Map location	4p16.3
Pascal p-value	0.59
Sherlock p-value	0.915
Fetal beta	0.017
eGene	Frontal Cortex BA9 Myers' cis & trans
Support	CompositeSet Darnell FMRP targets Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 6.0206

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
HTT	chr4	3215762	G	A	NM_002111	.	silent			Schizophrenia	DNM:Fromer_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs10497672		0	HTT	3064		0.02		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
DIO2	0.76	0.69
SLC1A3	0.73	0.69
GLUL	0.70	0.56
SLCO1C1	0.68	0.60
C4orf19	0.67	0.55
MERTK	0.65	0.56
ACSS3	0.64	0.57
PPP1R3C	0.64	0.59
HEPH	0.63	0.50
LYN	0.63	0.63

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TSPAN2	-0.33	-0.34
SNTG2	-0.31	-0.37
RAB33A	-0.30	-0.30
AC110814.1	-0.30	-0.28
SDC1	-0.30	-0.29
EFNA2	-0.30	-0.34
MED19	-0.30	-0.31
DPF1	-0.30	-0.22
RNF19B	-0.29	-0.24
FAM110A	-0.29	-0.28

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003714	transcription corepressor activity	TAS		10823891
GO:0005515	protein binding	IPI		7477378
GO:0005215	transporter activity	TAS		7568002
GO:0008017	microtubule binding	TAS		7568002
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006917	induction of apoptosis	TAS		9778247
GO:0009887	organ morphogenesis	TAS		7774020
GO:0009405	pathogenesis	TAS		10353249
GO:0007610	behavior	TAS		7774020
GO:0006915	apoptosis	TAS		8696339
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005794	Golgi apparatus	IDA		15837803
GO:0005625	soluble fraction	TAS		7568002
GO:0005634	nucleus	TAS		9778247
GO:0005737	cytoplasm	TAS		7568002

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AKT1	AKT \| MGC99656 \| PKB \| PKB-ALPHA \| PRKBA \| RAC \| RAC-ALPHA	v-akt murine thymoma viral oncogene homolog 1	Huntingtin is serine-phosphorylated by Akt.	BIND	12062094
AP2A2	ADTAB \| CLAPA2 \| HIP9 \| HYPJ	adaptor-related protein complex 2, alpha 2 subunit	Two-hybrid	BioGRID	9700202
CASP1	ICE \| IL1BC \| P45	caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)	Huntingtin interacts with caspase 1. This interaction was modeled on a demonstrated interaction between human huntingtin and caspase 1 from an unspecified species.	BIND	9535906
CASP1	ICE \| IL1BC \| P45	caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)	-	HPRD	9535906
CASP2	CASP-2 \| ICH-1L \| ICH-1L/1S \| ICH1 \| NEDD2	caspase 2, apoptosis-related cysteine peptidase	Htt interacts with caspase 2.	BIND	14713958
CASP3	CPP32 \| CPP32B \| SCA-1	caspase 3, apoptosis-related cysteine peptidase	Huntingtin interacts with caspase 3. This interaction was modeled on a demonstrated interaction between human Huntingtin and caspase 3 from an unspecified species.	BIND	9535906
CASP6	MCH2	caspase 6, apoptosis-related cysteine peptidase	Htt interacts with caspase 6.	BIND	14713958
CASP7	CMH-1 \| ICE-LAP3 \| MCH3	caspase 7, apoptosis-related cysteine peptidase	Htt interacts with caspase 7.	BIND	14713958
CASP8	ALPS2B \| CAP4 \| FLICE \| FLJ17672 \| MACH \| MCH5 \| MGC78473	caspase 8, apoptosis-related cysteine peptidase	Htt interacts with caspase 8.	BIND	14713958
CBS	HIP4	cystathionine-beta-synthase	-	HPRD	10434301
CREBBP	CBP \| KAT3A \| RSTS	CREB binding protein	CBP interacts with htt. This interaction was modeled on a demonstrated interaction between CBP and htt from unspecified species.	BIND	10823891
CREBBP	CBP \| KAT3A \| RSTS	CREB binding protein	-	HPRD,BioGRID	11264541
CREBBP	CBP \| KAT3A \| RSTS	CREB binding protein	Htt interacts with CBP.	BIND	15225551
CTBP1	BARS \| MGC104684	C-terminal binding protein 1	Huntingtin interacts with CTBP.	BIND	11739372
CTBP1	BARS \| MGC104684	C-terminal binding protein 1	-	HPRD,BioGRID	11739372
CXorf27	1700054O13Rik \| HIP17 \| HYPM	chromosome X open reading frame 27	Two-hybrid	BioGRID	9700202
DCTN1	DAP-150 \| DP-150 \| HMN7B \| P135	dynactin 1 (p150, glued homolog, Drosophila)	-	HPRD	9454836
DLG4	FLJ97752 \| FLJ98574 \| PSD95 \| SAP90	discs, large homolog 4 (Drosophila)	Huntingtin interacts with PSD-95.	BIND	11319238
DNAJB2	HSJ1 \| HSPF3	DnaJ (Hsp40) homolog, subfamily B, member 2	HSJ1a interacts with Htt-Q103.	BIND	15936278
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	-	HPRD,BioGRID	9079622
EIF2AK2	EIF2AK1 \| MGC126524 \| PKR \| PRKR	eukaryotic translation initiation factor 2-alpha kinase 2	PKR interacts with huntingtin mRNA.	BIND	11468270
F8A1	DXS522E \| F8A \| HAP40	coagulation factor VIII-associated (intronic transcript) 1	-	HPRD,BioGRID	11035034
FICD	HIP13 \| HYPE \| MGC5623 \| UNQ3041	FIC domain containing	-	HPRD,BioGRID	9700202
GAPDH	G3PD \| GAPD \| MGC88685	glyceraldehyde-3-phosphate dehydrogenase	-	HPRD,BioGRID	8612237
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	-	HPRD,BioGRID	9079622
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	HDP interacts with Grb2.	BIND	9079622
HAP1	HAP2 \| HIP5 \| HLP \| hHLP1	huntingtin-associated protein 1	Affinity Capture-Western in vitro in vivo Reconstituted Complex Two-hybrid	BioGRID	7477378 \|9454836 \|9599014 \|9668110
HAP1	HAP2 \| HIP5 \| HLP \| hHLP1	huntingtin-associated protein 1	Htt interacts with HAP1. This interaction was modeled on a demonstrated interaction between human Htt and Rat HAP1.	BIND	15654337
HAP1	HAP2 \| HIP5 \| HLP \| hHLP1	huntingtin-associated protein 1	Huntingtin interacts with HAP1.	BIND	9668110
HAP1	HAP2 \| HIP5 \| HLP \| hHLP1	huntingtin-associated protein 1	Htt interacts with Hap1.	BIND	7477378
HAP1	HAP2 \| HIP5 \| HLP \| hHLP1	huntingtin-associated protein 1	-	HPRD	7477378 \|9599014 \|9668110 \|10974549
HIP1	ILWEQ \| MGC126506	huntingtin interacting protein 1	-	HPRD,BioGRID	9147654 \|11063258
HIP1	ILWEQ \| MGC126506	huntingtin interacting protein 1	HIP1 interacts with HD.	BIND	11063258
HIP1R	FLJ14000 \| FLJ27022 \| HIP12 \| HIP3 \| ILWEQ \| KIAA0655 \| MGC47513	huntingtin interacting protein 1 related	-	HPRD	11063258
HSPA4	APG-2 \| HS24/P52 \| MGC131852 \| RY \| hsp70 \| hsp70RY	heat shock 70kDa protein 4	Htt interacts with HSP70.	BIND	15654337
HTT	HD \| IT15	huntingtin	Htt interacts with itself to form oligomers.	BIND	15225551
HYPK	HSPC136	Huntingtin interacting protein K	-	HPRD,BioGRID	9700202
IFT57	ESRRBL1 \| FLJ10147 \| HIPPI \| MHS4R2	intraflagellar transport 57 homolog (Chlamydomonas)	-	HPRD	11788820
MAGEA3	HIP8 \| HYPD \| MAGE3 \| MAGEA6 \| MGC14613	melanoma antigen family A, 3	Two-hybrid	BioGRID	9700202
MAP3K10	MLK2 \| MST	mitogen-activated protein kinase kinase kinase 10	MLK2 SH3 domain interacts with Huntingtin	BIND	10801775
MAP3K10	MLK2 \| MST	mitogen-activated protein kinase kinase kinase 10	-	HPRD,BioGRID	10801775
MED31	3110004H13Rik \| CGI-125 \| FLJ27436 \| FLJ36714 \| Soh1	mediator complex subunit 31	-	HPRD	15383276
NCOR1	KIAA1047 \| MGC104216 \| N-CoR \| TRAC1 \| hCIT529I10 \| hN-CoR	nuclear receptor co-repressor 1	HD interacts with N-CoR.	BIND	10441327
NCOR1	KIAA1047 \| MGC104216 \| N-CoR \| TRAC1 \| hCIT529I10 \| hN-CoR	nuclear receptor co-repressor 1	Two-hybrid	BioGRID	10441327
NEUROD1	BETA2 \| BHF-1 \| NEUROD \| bHLHa3	neurogenic differentiation 1	Affinity Capture-Western	BioGRID	12881483
OPTN	FIP2 \| GLC1E \| HIP7 \| HYPL \| NRP \| TFIIIA-INTP	optineurin	FIP-2 carboxy-terminus interacts with Huntingtin in perinuclear vesicular structures.	BIND	11137014
OPTN	FIP2 \| GLC1E \| HIP7 \| HYPL \| NRP \| TFIIIA-INTP	optineurin	-	HPRD,BioGRID	11137014
PACSIN1	KIAA1379 \| SDPI	protein kinase C and casein kinase substrate in neurons 1	-	HPRD,BioGRID	12354780
PACSIN1	KIAA1379 \| SDPI	protein kinase C and casein kinase substrate in neurons 1	huntingtin interacts with PACSIN1.	BIND	12354780
PRPF40A	FBP-11 \| FBP11 \| FLAF1 \| FLJ20585 \| FNBP3 \| HIP10 \| HYPA \| NY-REN-6	PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)	-	HPRD,BioGRID	9700202
PRPF40A	FBP-11 \| FBP11 \| FLAF1 \| FLJ20585 \| FNBP3 \| HIP10 \| HYPA \| NY-REN-6	PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)	Huntingtin interacts with HYPA	BIND	9700202
PRPF40B	HYPC	PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)	Huntingtin interacts with HYPC	BIND	9700202
PRPF40B	HYPC	PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)	-	HPRD,BioGRID	9700202
RASA1	CM-AVM \| CMAVM \| DKFZp434N071 \| GAP \| PKWS \| RASA \| RASGAP \| p120GAP \| p120RASGAP	RAS p21 protein activator (GTPase activating protein) 1	HDP interacts with RasGAP.	BIND	9079622
RASA1	CM-AVM \| CMAVM \| DKFZp434N071 \| GAP \| PKWS \| RASA \| RASGAP \| p120GAP \| p120RASGAP	RAS p21 protein activator (GTPase activating protein) 1	-	HPRD,BioGRID	9079622
SETD2	FLJ16420 \| FLJ22472 \| FLJ23184 \| FLJ45883 \| FLJ46217 \| HIF-1 \| HSPC069 \| HYPB \| KIAA1732 \| KMT3A \| SET2 \| p231HBP	SET domain containing 2	-	HPRD,BioGRID	9700202
SETD2	FLJ16420 \| FLJ22472 \| FLJ23184 \| FLJ45883 \| FLJ46217 \| HIF-1 \| HSPC069 \| HYPB \| KIAA1732 \| KMT3A \| SET2 \| p231HBP	SET domain containing 2	Huntingtin interacts with HYPB	BIND	9700202
SH3GL3	CNSA3 \| EEN-2B-L3 \| EEN-B2 \| HsT19371 \| SH3D2C \| SH3P13	SH3-domain GRB2-like 3	HD interacts with SH3GL3.	BIND	9809064
SH3GL3	CNSA3 \| EEN-2B-L3 \| EEN-B2 \| HsT19371 \| SH3D2C \| SH3P13	SH3-domain GRB2-like 3	-	HPRD,BioGRID	9809064
SH3GLB1	Bif-1 \| CGI-61 \| KIAA0491 \| dJ612B15.2	SH3-domain GRB2-like endophilin B1	-	HPRD,BioGRID	12456676
SIN3A	DKFZp434K2235 \| FLJ90319 \| KIAA0700	SIN3 homolog A, transcription regulator (yeast)	mSin3A interacts with htt. This interaction was modeled on a demonstrated interaction between mSin3A and htt from unspecified species.	BIND	10823891
SP1	-	Sp1 transcription factor	-	HPRD,BioGRID	11839795
SP1	-	Sp1 transcription factor	Huntingtin interacts with Sp1. This interaction was modelled on a demonstrated interaction between Huntingtin from human and Sp1 from rat.	BIND	11839795
SUMO1	DAP-1 \| GMP1 \| OFC10 \| PIC1 \| SENP2 \| SMT3 \| SMT3C \| SMT3H3 \| SUMO-1 \| UBL1	SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)	HD is covalently attached to SUMO-1 via lysine residues.	BIND	15064418
TAF4	FLJ41943 \| TAF2C \| TAF2C1 \| TAF4A \| TAFII130 \| TAFII135	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	TAFII130 interacts with htt.	BIND	11988536
TAF4	FLJ41943 \| TAF2C \| TAF2C1 \| TAF4A \| TAFII130 \| TAFII135	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	-	HPRD	11988536
TBP	GTF2D \| GTF2D1 \| MGC117320 \| MGC126054 \| MGC126055 \| SCA17 \| TFIID	TATA box binding protein	Htt interacts with TBP.	BIND	15225551
TBP	GTF2D \| GTF2D1 \| MGC117320 \| MGC126054 \| MGC126055 \| SCA17 \| TFIID	TATA box binding protein	-	HPRD	10410676
TCERG1	CA150 \| MGC133200 \| TAF2S	transcription elongation regulator 1	Htt interacts with CA150.	BIND	11172033
TCERG1	CA150 \| MGC133200 \| TAF2S	transcription elongation regulator 1	-	HPRD,BioGRID	11172033
TGM2	G-ALPHA-h \| GNAH \| TG2 \| TGC	transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)	Htt interacts with tTG.	BIND	11442349
TGM2	G-ALPHA-h \| GNAH \| TG2 \| TGC	transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)	-	HPRD	11442349
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	p53 interacts with htt. This interaction was modeled on a demonstrated interaction between p53 from human and htt from an unspecified species.	BIND	10823891
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	Htt interacts with TP53(p53).	BIND	15996546
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	-	HPRD,BioGRID	10823891
TPH1	MGC119994 \| TPH \| TPRH	tryptophan hydroxylase 1	-	HPRD	12354289
TPR	-	translocated promoter region (to activated MET oncogene)	Htt interacts with Tpr.	BIND	15654337
TRIP10	CIP4 \| HSTP \| STOT \| STP	thyroid hormone receptor interactor 10	htt interacts with CIP4.	BIND	12604778
TRIP10	CIP4 \| HSTP \| STOT \| STP	thyroid hormone receptor interactor 10	-	HPRD,BioGRID	12604778
UBE2K	DKFZp564C1216 \| DKFZp686J24237 \| E2-25K \| HIP2 \| HYPG \| LIG	ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast)	-	HPRD,BioGRID	8702625
UBE2K	DKFZp564C1216 \| DKFZp686J24237 \| E2-25K \| HIP2 \| HYPG \| LIG	ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast)	HD interacts with hE2-25K.	BIND	8702625
ZDHHC17	HIP14 \| HIP3 \| HSPC294 \| HYPH \| KIAA0946	zinc finger, DHHC-type containing 17	HIP14 catalyzes palmitoylation of htt. This interaction was modeled on a demonstrated interaction between human HIP14 and htt from an unspecified species.	BIND	15603740
ZDHHC17	HIP14 \| HIP3 \| HSPC294 \| HYPH \| KIAA0946	zinc finger, DHHC-type containing 17	-	HPRD,BioGRID	9700202 \|12393793
ZDHHC17	HIP14 \| HIP3 \| HSPC294 \| HYPH \| KIAA0946	zinc finger, DHHC-type containing 17	htt interacts with HIP14.	BIND	12393793

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG HUNTINGTONS DISEASE	185	109	All SZGR 2.0 genes in this pathway
PID P53 DOWNSTREAM PATHWAY	137	94	All SZGR 2.0 genes in this pathway
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS BLUE DN	61	35	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LPS UP	431	237	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS UP	293	179	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE UP	134	93	All SZGR 2.0 genes in this pathway
SCHEIDEREIT IKK INTERACTING PROTEINS	58	45	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR ANAPLASTIC UP	19	12	All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER DN	203	134	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP	479	299	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
MANTOVANI VIRAL GPCR SIGNALING DN	49	37	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS BY HNE AND TBH	60	42	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN	366	257	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 UP	167	99	All SZGR 2.0 genes in this pathway
HOFFMANN LARGE TO SMALL PRE BII LYMPHOCYTE UP	163	102	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN	457	302	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN	668	419	All SZGR 2.0 genes in this pathway
CROONQUIST NRAS VS STROMAL STIMULATION DN	99	65	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-137	3096	3102	1A	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-216	582	588	1A	hsa-miR-216	UAAUCUCAGCUGGCAACUGUG
miR-411	613	619	1A	hsa-miR-411	AACACGGUCCACUAACCCUCAGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: HTT