Gene Page: KRAS
Summary ?
GeneID | 3845 |
Symbol | KRAS |
Synonyms | C-K-RAS|CFC2|K-RAS2A|K-RAS2B|K-RAS4A|K-RAS4B|KI-RAS|KRAS1|KRAS2|NS|NS3|RALD|RASK2 |
Description | Kirsten rat sarcoma viral oncogene homolog |
Reference | MIM:190070|HGNC:HGNC:6407|Ensembl:ENSG00000133703|HPRD:01817|Vega:OTTHUMG00000171193 |
Gene type | protein-coding |
Map location | 12p12.1 |
Pascal p-value | 0.937 |
Sherlock p-value | 0.306 |
Fetal beta | 0.194 |
DMG | 1 (# studies) |
eGene | Meta |
Support | CANABINOID DOPAMINE INTRACELLULAR SIGNAL TRANSDUCTION METABOTROPIC GLUTAMATE RECEPTOR SEROTONIN G2Cdb.humanPSP CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0024 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg02850821 | 12 | 25403680 | KRAS | -0.024 | 0.68 | DMG:Nishioka_2013 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0003924 | GTPase activity | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0005515 | protein binding | IPI | 11857081 |12732644 | |
GO:0005525 | GTP binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0048169 | regulation of long-term neuronal synaptic plasticity | IEA | neuron, Synap (GO term level: 10) | - |
GO:0032228 | regulation of synaptic transmission, GABAergic | IEA | neuron, GABA, Synap, Neurotransmitter (GO term level: 9) | - |
GO:0043524 | negative regulation of neuron apoptosis | IEA | neuron (GO term level: 9) | - |
GO:0007265 | Ras protein signal transduction | EXP | 11520933 | |
GO:0007265 | Ras protein signal transduction | IEA | - | |
GO:0008284 | positive regulation of cell proliferation | IEA | - | |
GO:0008542 | visual learning | IEA | - | |
GO:0007605 | sensory perception of sound | IEA | - | |
GO:0007569 | cell aging | IEA | - | |
GO:0006897 | endocytosis | IEA | - | |
GO:0030036 | actin cytoskeleton organization | IEA | - | |
GO:0035022 | positive regulation of Rac protein signal transduction | IEA | - | |
GO:0051146 | striated muscle cell differentiation | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005624 | membrane fraction | IEA | - | |
GO:0005886 | plasma membrane | EXP | 7972015 |8493579 |9069260 |9690470 | |
GO:0005886 | plasma membrane | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
BCL2 | Bcl-2 | B-cell CLL/lymphoma 2 | - | HPRD | 10490827 |
EPB42 | MGC116735 | MGC116737 | PA | erythrocyte membrane protein band 4.2 | Reconstituted Complex | BioGRID | 3276554 |
HNRNPC | C1 | C2 | HNRNP | HNRPC | MGC104306 | MGC105117 | MGC117353 | MGC131677 | SNRPC | heterogeneous nuclear ribonucleoprotein C (C1/C2) | Two-hybrid | BioGRID | 16189514 |
HSPD1 | CPN60 | GROEL | HSP60 | HSP65 | HuCHA60 | SPG13 | heat shock 60kDa protein 1 (chaperonin) | in vivo | BioGRID | 11888933 |
PIK3CA | MGC142161 | MGC142163 | PI3K | p110-alpha | phosphoinositide-3-kinase, catalytic, alpha polypeptide | Two-hybrid | BioGRID | 10783161 |
PIK3CG | PI3CG | PI3K | PI3Kgamma | PIK3 | phosphoinositide-3-kinase, catalytic, gamma polypeptide | - | HPRD,BioGRID | 10542052 |
RAF1 | CRAF | NS5 | Raf-1 | c-Raf | v-raf-1 murine leukemia viral oncogene homolog 1 | Affinity Capture-Western Two-hybrid | BioGRID | 10783161 |10882715 |
RALGDS | FLJ20922 | RGF | RalGEF | ral guanine nucleotide dissociation stimulator | Reconstituted Complex Two-hybrid | BioGRID | 7809086 |10783161 |
RAP1GDS1 | GDS1 | MGC118859 | MGC118861 | SmgGDS | RAP1, GTP-GDP dissociation stimulator 1 | - | HPRD,BioGRID | 11948427 |
RASGRP2 | CALDAG-GEFI | CDC25L | RAS guanyl releasing protein 2 (calcium and DAG-regulated) | - | HPRD | 10918068 |
RASSF2 | DKFZp781O1747 | KIAA0168 | RASFADIN | Ras association (RalGDS/AF-6) domain family member 2 | - | HPRD,BioGRID | 12732644 |
RASSF5 | MGC10823 | MGC17344 | Maxp1 | NORE1 | NORE1A | NORE1B | RAPL | RASSF3 | Ras association (RalGDS/AF-6) domain family member 5 | - | HPRD,BioGRID | 11857081 |
SHOC2 | FLJ60412 | KIAA0862 | SIAA0862 | SOC-2 | SOC2 | SUR-8 | SUR8 | soc-2 suppressor of clear homolog (C. elegans) | - | HPRD,BioGRID | 9674433 |10783161 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG MAPK SIGNALING PATHWAY | 267 | 205 | All SZGR 2.0 genes in this pathway |
KEGG ERBB SIGNALING PATHWAY | 87 | 71 | All SZGR 2.0 genes in this pathway |
KEGG CHEMOKINE SIGNALING PATHWAY | 190 | 128 | All SZGR 2.0 genes in this pathway |
KEGG DORSO VENTRAL AXIS FORMATION | 25 | 21 | All SZGR 2.0 genes in this pathway |
KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
KEGG VEGF SIGNALING PATHWAY | 76 | 53 | All SZGR 2.0 genes in this pathway |
KEGG TIGHT JUNCTION | 134 | 86 | All SZGR 2.0 genes in this pathway |
KEGG GAP JUNCTION | 90 | 68 | All SZGR 2.0 genes in this pathway |
KEGG NATURAL KILLER CELL MEDIATED CYTOTOXICITY | 137 | 92 | All SZGR 2.0 genes in this pathway |
KEGG T CELL RECEPTOR SIGNALING PATHWAY | 108 | 89 | All SZGR 2.0 genes in this pathway |
KEGG B CELL RECEPTOR SIGNALING PATHWAY | 75 | 56 | All SZGR 2.0 genes in this pathway |
KEGG FC EPSILON RI SIGNALING PATHWAY | 79 | 58 | All SZGR 2.0 genes in this pathway |
KEGG LONG TERM POTENTIATION | 70 | 57 | All SZGR 2.0 genes in this pathway |
KEGG NEUROTROPHIN SIGNALING PATHWAY | 126 | 103 | All SZGR 2.0 genes in this pathway |
KEGG LONG TERM DEPRESSION | 70 | 53 | All SZGR 2.0 genes in this pathway |
KEGG REGULATION OF ACTIN CYTOSKELETON | 216 | 144 | All SZGR 2.0 genes in this pathway |
KEGG INSULIN SIGNALING PATHWAY | 137 | 103 | All SZGR 2.0 genes in this pathway |
KEGG GNRH SIGNALING PATHWAY | 101 | 77 | All SZGR 2.0 genes in this pathway |
KEGG PROGESTERONE MEDIATED OOCYTE MATURATION | 86 | 59 | All SZGR 2.0 genes in this pathway |
KEGG MELANOGENESIS | 102 | 80 | All SZGR 2.0 genes in this pathway |
KEGG ALDOSTERONE REGULATED SODIUM REABSORPTION | 42 | 29 | All SZGR 2.0 genes in this pathway |
KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
KEGG COLORECTAL CANCER | 62 | 47 | All SZGR 2.0 genes in this pathway |
KEGG RENAL CELL CARCINOMA | 70 | 60 | All SZGR 2.0 genes in this pathway |
KEGG PANCREATIC CANCER | 70 | 56 | All SZGR 2.0 genes in this pathway |
KEGG ENDOMETRIAL CANCER | 52 | 45 | All SZGR 2.0 genes in this pathway |
KEGG GLIOMA | 65 | 56 | All SZGR 2.0 genes in this pathway |
KEGG PROSTATE CANCER | 89 | 75 | All SZGR 2.0 genes in this pathway |
KEGG THYROID CANCER | 29 | 26 | All SZGR 2.0 genes in this pathway |
KEGG MELANOMA | 71 | 57 | All SZGR 2.0 genes in this pathway |
KEGG BLADDER CANCER | 42 | 33 | All SZGR 2.0 genes in this pathway |
KEGG CHRONIC MYELOID LEUKEMIA | 73 | 59 | All SZGR 2.0 genes in this pathway |
KEGG ACUTE MYELOID LEUKEMIA | 60 | 47 | All SZGR 2.0 genes in this pathway |
KEGG NON SMALL CELL LUNG CANCER | 54 | 47 | All SZGR 2.0 genes in this pathway |
BIOCARTA TEL PATHWAY | 18 | 15 | All SZGR 2.0 genes in this pathway |
PID GMCSF PATHWAY | 37 | 31 | All SZGR 2.0 genes in this pathway |
PID TCR PATHWAY | 66 | 51 | All SZGR 2.0 genes in this pathway |
PID ER NONGENOMIC PATHWAY | 41 | 35 | All SZGR 2.0 genes in this pathway |
PID EPHB FWD PATHWAY | 40 | 38 | All SZGR 2.0 genes in this pathway |
PID CD8 TCR PATHWAY | 53 | 42 | All SZGR 2.0 genes in this pathway |
PID SHP2 PATHWAY | 58 | 46 | All SZGR 2.0 genes in this pathway |
PID MTOR 4PATHWAY | 69 | 55 | All SZGR 2.0 genes in this pathway |
PID IL2 1PATHWAY | 55 | 43 | All SZGR 2.0 genes in this pathway |
PID ERBB1 RECEPTOR PROXIMAL PATHWAY | 35 | 29 | All SZGR 2.0 genes in this pathway |
PID TCR RAS PATHWAY | 14 | 14 | All SZGR 2.0 genes in this pathway |
PID PI3KCI PATHWAY | 49 | 40 | All SZGR 2.0 genes in this pathway |
PID ERBB1 DOWNSTREAM PATHWAY | 105 | 78 | All SZGR 2.0 genes in this pathway |
PID ERBB2 ERBB3 PATHWAY | 44 | 35 | All SZGR 2.0 genes in this pathway |
PID PDGFRB PATHWAY | 129 | 103 | All SZGR 2.0 genes in this pathway |
PID TRKR PATHWAY | 62 | 48 | All SZGR 2.0 genes in this pathway |
PID CMYB PATHWAY | 84 | 61 | All SZGR 2.0 genes in this pathway |
PID ERBB1 INTERNALIZATION PATHWAY | 41 | 35 | All SZGR 2.0 genes in this pathway |
PID CXCR3 PATHWAY | 43 | 34 | All SZGR 2.0 genes in this pathway |
PID RAS PATHWAY | 30 | 22 | All SZGR 2.0 genes in this pathway |
PID MAPK TRK PATHWAY | 34 | 31 | All SZGR 2.0 genes in this pathway |
PID PI3K PLC TRK PATHWAY | 36 | 31 | All SZGR 2.0 genes in this pathway |
PID CD8 TCR DOWNSTREAM PATHWAY | 65 | 56 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY SCF KIT | 78 | 59 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ERBB4 | 90 | 67 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ERBB2 | 101 | 78 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY CONSTITUTIVELY ACTIVE EGFR | 18 | 13 | All SZGR 2.0 genes in this pathway |
REACTOME GRB2 EVENTS IN ERBB2 SIGNALING | 22 | 20 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY EGFR IN CANCER | 109 | 80 | All SZGR 2.0 genes in this pathway |
REACTOME SHC1 EVENTS IN ERBB4 SIGNALING | 20 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME DOWNSTREAM SIGNALING EVENTS OF B CELL RECEPTOR BCR | 97 | 66 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY THE B CELL RECEPTOR BCR | 126 | 90 | All SZGR 2.0 genes in this pathway |
REACTOME INSULIN RECEPTOR SIGNALLING CASCADE | 87 | 64 | All SZGR 2.0 genes in this pathway |
REACTOME ARMS MEDIATED ACTIVATION | 17 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME PROLONGED ERK ACTIVATION EVENTS | 19 | 18 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING TO RAS | 27 | 23 | All SZGR 2.0 genes in this pathway |
REACTOME CELL SURFACE INTERACTIONS AT THE VASCULAR WALL | 91 | 65 | All SZGR 2.0 genes in this pathway |
REACTOME NGF SIGNALLING VIA TRKA FROM THE PLASMA MEMBRANE | 137 | 105 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING TO ERKS | 36 | 30 | All SZGR 2.0 genes in this pathway |
REACTOME P38MAPK EVENTS | 13 | 12 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY FGFR IN DISEASE | 127 | 88 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING TO P38 VIA RIT AND RIN | 15 | 14 | All SZGR 2.0 genes in this pathway |
REACTOME GASTRIN CREB SIGNALLING PATHWAY VIA PKC AND MAPK | 205 | 136 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY FGFR MUTANTS | 44 | 29 | All SZGR 2.0 genes in this pathway |
REACTOME SHC1 EVENTS IN EGFR SIGNALING | 15 | 13 | All SZGR 2.0 genes in this pathway |
REACTOME TIE2 SIGNALING | 17 | 13 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY PDGF | 122 | 93 | All SZGR 2.0 genes in this pathway |
REACTOME DOWNSTREAM SIGNAL TRANSDUCTION | 95 | 76 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME NCAM SIGNALING FOR NEURITE OUT GROWTH | 64 | 49 | All SZGR 2.0 genes in this pathway |
REACTOME FRS2 MEDIATED CASCADE | 36 | 27 | All SZGR 2.0 genes in this pathway |
REACTOME DOWNSTREAM SIGNALING OF ACTIVATED FGFR | 100 | 74 | All SZGR 2.0 genes in this pathway |
REACTOME SHC MEDIATED CASCADE | 28 | 19 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ILS | 107 | 86 | All SZGR 2.0 genes in this pathway |
REACTOME IL 2 SIGNALING | 41 | 34 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY INSULIN RECEPTOR | 108 | 72 | All SZGR 2.0 genes in this pathway |
REACTOME SOS MEDIATED SIGNALLING | 14 | 13 | All SZGR 2.0 genes in this pathway |
REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
REACTOME RAF MAP KINASE CASCADE | 10 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME SHC MEDIATED SIGNALLING | 15 | 12 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME ADAPTIVE IMMUNE SYSTEM | 539 | 350 | All SZGR 2.0 genes in this pathway |
REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM | 270 | 204 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY FGFR | 112 | 80 | All SZGR 2.0 genes in this pathway |
REACTOME SHC RELATED EVENTS | 17 | 13 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP | 285 | 181 | All SZGR 2.0 genes in this pathway |
KORKOLA EMBRYONAL CARCINOMA UP | 41 | 27 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP | 408 | 247 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
ODONNELL TFRC TARGETS UP | 456 | 228 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
TAKADA GASTRIC CANCER COPY NUMBER UP | 7 | 5 | All SZGR 2.0 genes in this pathway |
YANAGIHARA ESX1 TARGETS | 30 | 19 | All SZGR 2.0 genes in this pathway |
MANN RESPONSE TO AMIFOSTINE DN | 10 | 5 | All SZGR 2.0 genes in this pathway |
GRUETZMANN PANCREATIC CANCER DN | 203 | 134 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
BENPORATH CYCLING GENES | 648 | 385 | All SZGR 2.0 genes in this pathway |
DING LUNG CANCER MUTATED SIGNIFICANTLY | 26 | 22 | All SZGR 2.0 genes in this pathway |
SWEET KRAS TARGETS DN | 66 | 39 | All SZGR 2.0 genes in this pathway |
PENG GLUCOSE DEPRIVATION DN | 169 | 112 | All SZGR 2.0 genes in this pathway |
HU GENOTOXIN ACTION DIRECT VS INDIRECT 4HR | 37 | 22 | All SZGR 2.0 genes in this pathway |
RAMALHO STEMNESS UP | 206 | 118 | All SZGR 2.0 genes in this pathway |
ABE VEGFA TARGETS 30MIN | 29 | 21 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
LIN MELANOMA COPY NUMBER UP | 73 | 53 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
LABBE TGFB1 TARGETS UP | 102 | 64 | All SZGR 2.0 genes in this pathway |
BRUECKNER TARGETS OF MIRLET7A3 UP | 111 | 69 | All SZGR 2.0 genes in this pathway |
GRESHOCK CANCER COPY NUMBER UP | 323 | 240 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C CLUSTER UP | 38 | 26 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS UP | 491 | 316 | All SZGR 2.0 genes in this pathway |
BRUNEAU SEPTATION VENTRICULAR | 10 | 8 | All SZGR 2.0 genes in this pathway |
SHAFFER IRF4 TARGETS IN MYELOMA VS MATURE B LYMPHOCYTE | 101 | 76 | All SZGR 2.0 genes in this pathway |
SHAFFER IRF4 TARGETS IN PLASMA CELL VS MATURE B LYMPHOCYTE | 67 | 51 | All SZGR 2.0 genes in this pathway |
SHAFFER IRF4 TARGETS IN ACTIVATED B LYMPHOCYTE | 81 | 66 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
DING LUNG CANCER MUTATED RECURRENTLY | 6 | 5 | All SZGR 2.0 genes in this pathway |
WONG EMBRYONIC STEM CELL CORE | 335 | 193 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 11 | 103 | 68 | All SZGR 2.0 genes in this pathway |
WHITFIELD CELL CYCLE M G1 | 148 | 95 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
IKEDA MIR30 TARGETS UP | 116 | 87 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 3352 | 3358 | 1A | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-134 | 3506 | 3512 | 1A | hsa-miR-134brain | UGUGACUGGUUGACCAGAGGG |
miR-143 | 1599 | 1606 | 1A,m8 | hsa-miR-143brain | UGAGAUGAAGCACUGUAGCUCA |
hsa-miR-143brain | UGAGAUGAAGCACUGUAGCUCA | ||||
miR-155 | 84 | 90 | m8 | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
miR-19 | 3567 | 3573 | 1A | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-190 | 4378 | 4384 | 1A | hsa-miR-190 | UGAUAUGUUUGAUAUAUUAGGU |
miR-193 | 182 | 188 | 1A | hsa-miR-193a | AACUGGCCUACAAAGUCCCAG |
hsa-miR-193b | AACUGGCCCUCAAAGUCCCGCUUU | ||||
miR-199 | 1497 | 1503 | 1A | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
miR-200bc/429 | 184 | 190 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-216 | 1245 | 1251 | m8 | hsa-miR-216 | UAAUCUCAGCUGGCAACUGUG |
miR-217 | 4320 | 4326 | m8 | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU | ||||
miR-27 | 4447 | 4453 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-30-3p | 4273 | 4279 | m8 | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC | ||||
miR-30-5p | 4231 | 4237 | m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-346 | 716 | 722 | m8 | hsa-miR-346brain | UGUCUGCCCGCAUGCCUGCCUCU |
miR-381 | 4260 | 4266 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-433-3p | 4480 | 4486 | 1A | hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU |
miR-448 | 4318 | 4324 | m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
miR-505 | 4162 | 4168 | 1A | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC | ||||
miR-543 | 4368 | 4374 | m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
miR-96 | 4193 | 4199 | m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.