Gene Page: MST1R
Summary ?
GeneID | 4486 |
Symbol | MST1R |
Synonyms | CD136|CDw136|PTK8|RON |
Description | macrophage stimulating 1 receptor |
Reference | MIM:600168|HGNC:HGNC:7381|Ensembl:ENSG00000164078|HPRD:02545|Vega:OTTHUMG00000156709 |
Gene type | protein-coding |
Map location | 3p21.3 |
Pascal p-value | 0.001 |
Fetal beta | 0.635 |
DMG | 1 (# studies) |
eGene | Cerebellar Hemisphere Cerebellum Cortex |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0161 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg24980367 | 3 | 49941378 | MST1R | 2.03E-8 | -0.013 | 7.02E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0005011 | macrophage colony stimulating factor receptor activity | TAS | 9045873 | |
GO:0004872 | receptor activity | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006468 | protein amino acid phosphorylation | IEA | - | |
GO:0007338 | single fertilization | TAS | 9045873 | |
GO:0007165 | signal transduction | TAS | 7939629 | |
GO:0008284 | positive regulation of cell proliferation | TAS | 10871856 | |
GO:0006952 | defense response | TAS | 9045873 | |
GO:0006928 | cell motion | TAS | 9045873 | |
GO:0007275 | multicellular organismal development | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0001725 | stress fiber | IEA | - | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 7939629 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID AMB2 NEUTROPHILS PATHWAY | 41 | 32 | All SZGR 2.0 genes in this pathway |
PID A6B1 A6B4 INTEGRIN PATHWAY | 46 | 35 | All SZGR 2.0 genes in this pathway |
JAEGER METASTASIS DN | 258 | 141 | All SZGR 2.0 genes in this pathway |
COLDREN GEFITINIB RESISTANCE DN | 230 | 115 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
HERNANDEZ MITOTIC ARREST BY DOCETAXEL 2 DN | 19 | 13 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
NUMATA CSF3 SIGNALING VIA STAT3 | 22 | 17 | All SZGR 2.0 genes in this pathway |
KANG FLUOROURACIL RESISTANCE DN | 16 | 10 | All SZGR 2.0 genes in this pathway |
BILD MYC ONCOGENIC SIGNATURE | 206 | 117 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
MIKKELSEN IPS ICP WITH H3K4ME3 AND H327ME3 | 126 | 83 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES ICP WITH H3K4ME3 AND H3K27ME3 | 137 | 85 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 | 403 | 240 | All SZGR 2.0 genes in this pathway |
WANG MLL TARGETS | 289 | 188 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
BRIDEAU IMPRINTED GENES | 63 | 47 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-324-3p | 242 | 248 | 1A | hsa-miR-324-3p | CCACUGCCCCAGGUGCUGCUGG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.