Gene Page: SEPT2
Summary ?
GeneID | 4735 |
Symbol | SEPT2 |
Synonyms | DIFF6|NEDD-5|NEDD5|Pnutl3|hNedd5 |
Description | septin 2 |
Reference | MIM:601506|HGNC:HGNC:7729|Ensembl:ENSG00000168385|HPRD:03297|Vega:OTTHUMG00000133394 |
Gene type | protein-coding |
Map location | 2q37 |
Pascal p-value | 0.123 |
Sherlock p-value | 0.299 |
eGene | Anterior cingulate cortex BA24 Caudate basal ganglia Cerebellar Hemisphere Cerebellum Cortex Hypothalamus Nucleus accumbens basal ganglia |
Support | PROTEIN CLUSTERING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0778 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs3755397 | 2 | 242294913 | SEPT2 | ENSG00000168385.13 | 4.16226E-9 | 0 | 39637 | gtex_brain_ba24 |
rs141753202 | 2 | 242352633 | SEPT2 | ENSG00000168385.13 | 1.34629E-9 | 0 | 97357 | gtex_brain_ba24 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
TIAM2 | 0.93 | 0.86 |
EML1 | 0.92 | 0.82 |
FOXG1B | 0.92 | 0.91 |
TMEM108 | 0.91 | 0.87 |
TP53I11 | 0.90 | 0.88 |
DAB1 | 0.90 | 0.89 |
SEZ6 | 0.89 | 0.84 |
NCK2 | 0.89 | 0.84 |
DACT1 | 0.89 | 0.87 |
ZNF238 | 0.89 | 0.93 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SERPINB6 | -0.64 | -0.70 |
AP003117.1 | -0.61 | -0.62 |
AIFM3 | -0.61 | -0.74 |
HEPN1 | -0.60 | -0.70 |
C5orf53 | -0.60 | -0.65 |
AC007405.8 | -0.60 | -0.67 |
HLA-F | -0.60 | -0.68 |
ALDOC | -0.59 | -0.64 |
FBXO2 | -0.59 | -0.57 |
LDHD | -0.59 | -0.61 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0005515 | protein binding | IPI | 10321247 | |
GO:0005525 | GTP binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007049 | cell cycle | IEA | - | |
GO:0051301 | cell division | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IDA | 10942595 | |
GO:0005737 | cytoplasm | IDA | 10942595 | |
GO:0031105 | septin complex | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID CDC42 PATHWAY | 70 | 51 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
BARIS THYROID CANCER DN | 59 | 45 | All SZGR 2.0 genes in this pathway |
SEIDEN MET SIGNALING | 19 | 16 | All SZGR 2.0 genes in this pathway |
MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
NING CHRONIC OBSTRUCTIVE PULMONARY DISEASE DN | 121 | 79 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
IGLESIAS E2F TARGETS UP | 151 | 103 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C6 | 39 | 27 | All SZGR 2.0 genes in this pathway |
MURAKAMI UV RESPONSE 6HR UP | 37 | 31 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
HSIAO HOUSEKEEPING GENES | 389 | 245 | All SZGR 2.0 genes in this pathway |
NGO MALIGNANT GLIOMA 1P LOH | 17 | 13 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA UP | 207 | 143 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-15/16/195/424/497 | 542 | 549 | 1A,m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-485-3p | 171 | 178 | 1A,m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.