Gene Page: NFKBIA
Summary ?
GeneID | 4792 |
Symbol | NFKBIA |
Synonyms | IKBA|MAD-3|NFKBI |
Description | NFKB inhibitor alpha |
Reference | MIM:164008|HGNC:HGNC:7797|Ensembl:ENSG00000100906|HPRD:01235|Vega:OTTHUMG00000140220 |
Gene type | protein-coding |
Map location | 14q13 |
Pascal p-value | 0.001 |
Sherlock p-value | 0.469 |
Fetal beta | -0.267 |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.1501 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs1346726 | chr8 | 27335218 | NFKBIA | 4792 | 0.05 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0008139 | nuclear localization sequence binding | IPI | 1493333 | |
GO:0031625 | ubiquitin protein ligase binding | IPI | 9859996 | |
GO:0051059 | NF-kappaB binding | IPI | 7739562 | |
GO:0042802 | identical protein binding | IPI | 16951195 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000060 | protein import into nucleus, translocation | IEA | - | |
GO:0007253 | cytoplasmic sequestering of NF-kappaB | NAS | - | |
GO:0006915 | apoptosis | TAS | 10747850 | |
GO:0042345 | regulation of NF-kappaB import into nucleus | NAS | 3140380 | |
GO:0042127 | regulation of cell proliferation | IEA | - | |
GO:0032496 | response to lipopolysaccharide | IEA | - | |
GO:0031663 | lipopolysaccharide-mediated signaling pathway | IEA | - | |
GO:0043392 | negative regulation of DNA binding | NAS | 3140380 | |
GO:0043330 | response to exogenous dsRNA | IEA | - | |
GO:0032495 | response to muramyl dipeptide | IEA | - | |
GO:0045638 | negative regulation of myeloid cell differentiation | IEA | - | |
GO:0045746 | negative regulation of Notch signaling pathway | IEA | - | |
GO:0044419 | interspecies interaction between organisms | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005829 | cytosol | EXP | 10723127 | |
GO:0005829 | cytosol | IEA | - | |
GO:0005634 | nucleus | IDA | 7679069 | |
GO:0005737 | cytoplasm | IDA | 3140380 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ARRB1 | ARB1 | ARR1 | arrestin, beta 1 | Beta-Arr1 interacts with I-kappa-B-alpha to prevent the phosphorylation and degradation of I-kappa-B-alpha. | BIND | 15125834 |
ARRB2 | ARB2 | ARR2 | BARR2 | DKFZp686L0365 | arrestin, beta 2 | The amino terminus of Beta-Arr2 interacts with the carboxy terminus of I-kappa-B-alpha to prevent I-kappa-B-alpha phosphorylation and degradation. | BIND | 15125834 |
BARD1 | - | BRCA1 associated RING domain 1 | Two-hybrid | BioGRID | 10362352 |
BTRC | BETA-TRCP | FBW1A | FBXW1 | FBXW1A | FWD1 | MGC4643 | bTrCP | bTrCP1 | betaTrCP | beta-transducin repeat containing | - | HPRD,BioGRID | 9990853 |
BTRC | BETA-TRCP | FBW1A | FBXW1 | FBXW1A | FWD1 | MGC4643 | bTrCP | bTrCP1 | betaTrCP | beta-transducin repeat containing | h-beta-TrCP interacts with and promotes ubiquitination of phosphorylated I-kappa-B-alpha. This interaction was modeled on a demonstrated interaction between human beta-TrCP (h-beta-TrCP) and I-kappa-B-alpha from an unspecified species. | BIND | 9990853 |
CAPN1 | CANP | CANP1 | CANPL1 | muCANP | muCL | calpain 1, (mu/I) large subunit | - | HPRD,BioGRID | 10521480 |
CHUK | IKBKA | IKK-alpha | IKK1 | IKKA | NFKBIKA | TCF16 | conserved helix-loop-helix ubiquitous kinase | Biochemical Activity Reconstituted Complex | BioGRID | 9252186 |9751059 |
CHUK | IKBKA | IKK-alpha | IKK1 | IKKA | NFKBIKA | TCF16 | conserved helix-loop-helix ubiquitous kinase | IKK-alpha phosphorylates I-kappa-B-alpha. | BIND | 9346485 |
CHUK | IKBKA | IKK-alpha | IKK1 | IKKA | NFKBIKA | TCF16 | conserved helix-loop-helix ubiquitous kinase | Ikk-alpha phosphorylates I-kappa-B-alpha. This interaction was modeled on a demonstrated interaction between human IKK-alpha and I-kappa-B-alpha from an unspecified species. | BIND | 15782119 |
COMMD1 | C2orf5 | MGC27155 | MURR1 | copper metabolism (Murr1) domain containing 1 | Affinity Capture-Western | BioGRID | 14685242 |
COMMD1 | C2orf5 | MGC27155 | MURR1 | copper metabolism (Murr1) domain containing 1 | Murr1 interacts with I-kappaB-alpha | BIND | 14685242 |
DYNLL1 | DLC1 | DLC8 | DNCL1 | DNCLC1 | LC8 | LC8a | MGC126137 | MGC126138 | PIN | hdlc1 | dynein, light chain, LC8-type 1 | - | HPRD,BioGRID | 9372968 |
DYNLL1 | DLC1 | DLC8 | DNCL1 | DNCLC1 | LC8 | LC8a | MGC126137 | MGC126138 | PIN | hdlc1 | dynein, light chain, LC8-type 1 | I-kappa-B-alpha interacts with Dlc-1. | BIND | 9372968 |
ELP3 | FLJ10422 | KAT9 | elongation protein 3 homolog (S. cerevisiae) | - | HPRD | 14743216 |
ERC1 | Cast2 | ELKS | KIAA1081 | MGC12974 | RAB6IP2 | ELKS/RAB6-interacting/CAST family member 1 | ELKS interacts with I-kappa-B-alpha. | BIND | 15218148 |
FBXW11 | BTRC2 | BTRCP2 | FBW1B | FBXW1B | Fbw11 | Hos | KIAA0696 | F-box and WD repeat domain containing 11 | - | HPRD,BioGRID | 10644755 |
G3BP2 | - | GTPase activating protein (SH3 domain) binding protein 2 | - | HPRD,BioGRID | 10969074 |
HDAC1 | DKFZp686H12203 | GON-10 | HD1 | RPD3 | RPD3L1 | histone deacetylase 1 | HDAC1 interacts with I-kappa-B-alpha. | BIND | 12972430 |
HDAC3 | HD3 | RPD3 | RPD3-2 | histone deacetylase 3 | HDAC3 interacts with I-kappa-B-alpha. | BIND | 12972430 |
HNRNPA1 | HNRPA1 | MGC102835 | heterogeneous nuclear ribonucleoprotein A1 | Affinity Capture-Western Reconstituted Complex | BioGRID | 11313474 |
HNRNPAB | ABBP1 | FLJ40338 | HNRPAB | heterogeneous nuclear ribonucleoprotein A/B | - | HPRD | 11313474 |
HOXB7 | HHO.C1 | HOX2 | HOX2C | Hox-2.3 | homeobox B7 | - | HPRD,BioGRID | 10026139 |
HSPA8 | HSC54 | HSC70 | HSC71 | HSP71 | HSP73 | HSPA10 | LAP1 | MGC131511 | MGC29929 | NIP71 | heat shock 70kDa protein 8 | - | HPRD | 14743216 |
IKBKAP | DKFZp781H1425 | DYS | ELP1 | FD | FLJ12497 | IKAP | IKI3 | TOT1 | inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein | Reconstituted Complex | BioGRID | 9751059 |
IKBKB | FLJ40509 | IKK-beta | IKK2 | IKKB | MGC131801 | NFKBIKB | inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta | IKK-beta interacts with and phosphorylates I-kappa-B-alpha. | BIND | 9346485 |
IKBKB | FLJ40509 | IKK-beta | IKK2 | IKKB | MGC131801 | NFKBIKB | inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta | IKK-beta interacts with and phosphorylates I-kappa-B-alpha. This interaction was modelled on a demonstrated interaction between IKK-beta and I-kappa-B-alpha both from unspecified species. | BIND | 15808510 |
IKBKB | FLJ40509 | IKK-beta | IKK2 | IKKB | MGC131801 | NFKBIKB | inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta | Reconstituted Complex | BioGRID | 9751059 |9891086 |
IKBKB | FLJ40509 | IKK-beta | IKK2 | IKKB | MGC131801 | NFKBIKB | inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta | IKK-beta phosphorylates I-kappa-Ba. This interaction was modelled on a demonstrated interaction between IKK-beta from unknown species and I-kappa-Ba from unknown species. | BIND | 15084260 |
LCK | YT16 | p56lck | pp58lck | lymphocyte-specific protein tyrosine kinase | LCK interacts with and phosphorylates NFKBIA (I-kappa-B-alpha). This interaction was modeled on a demonstrated interaction between LCK from an unspecified species and human NFKBIA. | BIND | 14534291 |
MAP3K14 | FTDCR1B | HS | HSNIK | NIK | mitogen-activated protein kinase kinase kinase 14 | Reconstituted Complex | BioGRID | 9751059 |
MCM7 | CDABP0042 | CDC47 | MCM2 | P1.1-MCM3 | P1CDC47 | P85MCM | PNAS-146 | minichromosome maintenance complex component 7 | - | HPRD | 14743216 |
MED19 | DT2P1G7 | LCMR1 | mediator complex subunit 19 | Two-hybrid | BioGRID | 16169070 |
NCOR2 | CTG26 | SMRT | SMRTE | SMRTE-tau | TNRC14 | TRAC-1 | TRAC1 | nuclear receptor co-repressor 2 | Affinity Capture-Western | BioGRID | 12589049 |
NFKB1 | DKFZp686C01211 | EBP-1 | KBF1 | MGC54151 | NF-kappa-B | NFKB-p105 | NFKB-p50 | p105 | nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 | - | HPRD,BioGRID | 9738011 |
NFKB1 | DKFZp686C01211 | EBP-1 | KBF1 | MGC54151 | NF-kappa-B | NFKB-p105 | NFKB-p50 | p105 | nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 | p50 associates with I-kappa-B-alpha. | BIND | 9135156 |
PIK3R1 | GRB1 | p85 | p85-ALPHA | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | - | HPRD,BioGRID | 9892650 |
PIR | - | pirin (iron-binding nuclear protein) | Two-hybrid | BioGRID | 10362352 |
POM121 | DKFZp586G1822 | DKFZp586P2220 | FLJ41820 | KIAA0618 | MGC3792 | POM121A | POM121 membrane glycoprotein (rat) | Two-hybrid | BioGRID | 16189514 |
PTPN13 | DKFZp686J1497 | FAP-1 | PNP1 | PTP-BAS | PTP-BL | PTP1E | PTPL1 | PTPLE | protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase) | - | HPRD,BioGRID | 9882613 |
REL | C-Rel | v-rel reticuloendotheliosis viral oncogene homolog (avian) | Affinity Capture-Western | BioGRID | 10706725 |
RELA | MGC131774 | NFKB3 | p65 | v-rel reticuloendotheliosis viral oncogene homolog A (avian) | Affinity Capture-Western Reconstituted Complex | BioGRID | 8139561 |9738011 |9751059 |9990853 |11313474 |11533489 |12419806 |
RELA | MGC131774 | NFKB3 | p65 | v-rel reticuloendotheliosis viral oncogene homolog A (avian) | I-kappa-B-alpha interacts with NF-kappa-B-p65. | BIND | 15125834 |
RELA | MGC131774 | NFKB3 | p65 | v-rel reticuloendotheliosis viral oncogene homolog A (avian) | RelA, the p65 subunit of the NF-kappaB complex, interacts with I-kappaB-alpha | BIND | 14685242 |
RPS27L | - | ribosomal protein S27-like | - | HPRD | 14743216 |
RPS6KA1 | HU-1 | MAPKAPK1A | RSK | RSK1 | ribosomal protein S6 kinase, 90kDa, polypeptide 1 | - | HPRD,BioGRID | 9214631 |
SUMO4 | IDDM5 | SMT3H4 | SUMO-4 | dJ281H8.4 | SMT3 suppressor of mif two 3 homolog 4 (S. cerevisiae) | - | HPRD,BioGRID | 15247916 |
TIMM50 | MGC102733 | TIM50 | TIM50L | translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) | - | HPRD | 14743216 |
TNFSF11 | CD254 | ODF | OPGL | OPTB2 | RANKL | TRANCE | hRANKL2 | sOdf | tumor necrosis factor (ligand) superfamily, member 11 | - | HPRD | 10635328 |
TP53 | FLJ92943 | LFS1 | TRP53 | p53 | tumor protein p53 | - | HPRD,BioGRID | 11799106 |
TUBA1B | K-ALPHA-1 | tubulin, alpha 1b | - | HPRD | 9372968 |
TUBA3C | TUBA2 | bA408E5.3 | tubulin, alpha 3c | - | HPRD | 9372968 |
UBE2E3 | UBCH9 | UbcM2 | ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) | - | HPRD,BioGRID | 9409737 |
VCP | IBMPFD | MGC131997 | MGC148092 | MGC8560 | TERA | p97 | valosin-containing protein | - | HPRD,BioGRID | 9452483 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CHEMOKINE SIGNALING PATHWAY | 190 | 128 | All SZGR 2.0 genes in this pathway |
KEGG APOPTOSIS | 88 | 62 | All SZGR 2.0 genes in this pathway |
KEGG TOLL LIKE RECEPTOR SIGNALING PATHWAY | 102 | 88 | All SZGR 2.0 genes in this pathway |
KEGG NOD LIKE RECEPTOR SIGNALING PATHWAY | 62 | 47 | All SZGR 2.0 genes in this pathway |
KEGG RIG I LIKE RECEPTOR SIGNALING PATHWAY | 71 | 51 | All SZGR 2.0 genes in this pathway |
KEGG CYTOSOLIC DNA SENSING PATHWAY | 56 | 44 | All SZGR 2.0 genes in this pathway |
KEGG T CELL RECEPTOR SIGNALING PATHWAY | 108 | 89 | All SZGR 2.0 genes in this pathway |
KEGG B CELL RECEPTOR SIGNALING PATHWAY | 75 | 56 | All SZGR 2.0 genes in this pathway |
KEGG NEUROTROPHIN SIGNALING PATHWAY | 126 | 103 | All SZGR 2.0 genes in this pathway |
KEGG ADIPOCYTOKINE SIGNALING PATHWAY | 67 | 57 | All SZGR 2.0 genes in this pathway |
KEGG EPITHELIAL CELL SIGNALING IN HELICOBACTER PYLORI INFECTION | 68 | 44 | All SZGR 2.0 genes in this pathway |
KEGG LEISHMANIA INFECTION | 72 | 56 | All SZGR 2.0 genes in this pathway |
KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
KEGG PROSTATE CANCER | 89 | 75 | All SZGR 2.0 genes in this pathway |
KEGG CHRONIC MYELOID LEUKEMIA | 73 | 59 | All SZGR 2.0 genes in this pathway |
KEGG SMALL CELL LUNG CANCER | 84 | 67 | All SZGR 2.0 genes in this pathway |
BIOCARTA RELA PATHWAY | 16 | 12 | All SZGR 2.0 genes in this pathway |
BIOCARTA AKT PATHWAY | 22 | 16 | All SZGR 2.0 genes in this pathway |
BIOCARTA ATM PATHWAY | 20 | 16 | All SZGR 2.0 genes in this pathway |
BIOCARTA CDMAC PATHWAY | 16 | 15 | All SZGR 2.0 genes in this pathway |
BIOCARTA CD40 PATHWAY | 15 | 13 | All SZGR 2.0 genes in this pathway |
BIOCARTA TID PATHWAY | 19 | 15 | All SZGR 2.0 genes in this pathway |
BIOCARTA RNA PATHWAY | 10 | 9 | All SZGR 2.0 genes in this pathway |
BIOCARTA EPONFKB PATHWAY | 11 | 11 | All SZGR 2.0 genes in this pathway |
BIOCARTA FMLP PATHWAY | 39 | 29 | All SZGR 2.0 genes in this pathway |
BIOCARTA HIVNEF PATHWAY | 58 | 43 | All SZGR 2.0 genes in this pathway |
BIOCARTA DEATH PATHWAY | 33 | 24 | All SZGR 2.0 genes in this pathway |
BIOCARTA RACCYCD PATHWAY | 26 | 23 | All SZGR 2.0 genes in this pathway |
BIOCARTA KERATINOCYTE PATHWAY | 46 | 38 | All SZGR 2.0 genes in this pathway |
BIOCARTA MAPK PATHWAY | 87 | 68 | All SZGR 2.0 genes in this pathway |
BIOCARTA PPARA PATHWAY | 58 | 43 | All SZGR 2.0 genes in this pathway |
BIOCARTA VIP PATHWAY | 29 | 26 | All SZGR 2.0 genes in this pathway |
BIOCARTA NTHI PATHWAY | 24 | 20 | All SZGR 2.0 genes in this pathway |
BIOCARTA NFKB PATHWAY | 23 | 19 | All SZGR 2.0 genes in this pathway |
BIOCARTA IL1R PATHWAY | 33 | 29 | All SZGR 2.0 genes in this pathway |
BIOCARTA TCR PATHWAY | 49 | 37 | All SZGR 2.0 genes in this pathway |
BIOCARTA 41BB PATHWAY | 17 | 15 | All SZGR 2.0 genes in this pathway |
BIOCARTA STRESS PATHWAY | 25 | 18 | All SZGR 2.0 genes in this pathway |
BIOCARTA TNFR2 PATHWAY | 18 | 15 | All SZGR 2.0 genes in this pathway |
BIOCARTA TOLL PATHWAY | 37 | 31 | All SZGR 2.0 genes in this pathway |
ST TUMOR NECROSIS FACTOR PATHWAY | 29 | 20 | All SZGR 2.0 genes in this pathway |
SIG CD40PATHWAYMAP | 34 | 28 | All SZGR 2.0 genes in this pathway |
ST GAQ PATHWAY | 28 | 22 | All SZGR 2.0 genes in this pathway |
ST GA13 PATHWAY | 37 | 32 | All SZGR 2.0 genes in this pathway |
ST T CELL SIGNAL TRANSDUCTION | 45 | 33 | All SZGR 2.0 genes in this pathway |
ST B CELL ANTIGEN RECEPTOR | 40 | 32 | All SZGR 2.0 genes in this pathway |
ST FAS SIGNALING PATHWAY | 65 | 54 | All SZGR 2.0 genes in this pathway |
PID BCR 5PATHWAY | 65 | 50 | All SZGR 2.0 genes in this pathway |
PID LYSOPHOSPHOLIPID PATHWAY | 66 | 53 | All SZGR 2.0 genes in this pathway |
PID NFKAPPAB ATYPICAL PATHWAY | 17 | 15 | All SZGR 2.0 genes in this pathway |
PID NFKAPPAB CANONICAL PATHWAY | 23 | 20 | All SZGR 2.0 genes in this pathway |
PID CD40 PATHWAY | 31 | 26 | All SZGR 2.0 genes in this pathway |
PID AVB3 OPN PATHWAY | 31 | 29 | All SZGR 2.0 genes in this pathway |
PID HDAC CLASSI PATHWAY | 66 | 50 | All SZGR 2.0 genes in this pathway |
PID CERAMIDE PATHWAY | 48 | 37 | All SZGR 2.0 genes in this pathway |
PID IL23 PATHWAY | 37 | 30 | All SZGR 2.0 genes in this pathway |
PID HIV NEF PATHWAY | 35 | 26 | All SZGR 2.0 genes in this pathway |
PID AURORA A PATHWAY | 31 | 20 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
REACTOME TRIF MEDIATED TLR3 SIGNALING | 74 | 54 | All SZGR 2.0 genes in this pathway |
REACTOME RIP MEDIATED NFKB ACTIVATION VIA DAI | 18 | 15 | All SZGR 2.0 genes in this pathway |
REACTOME DOWNSTREAM SIGNALING EVENTS OF B CELL RECEPTOR BCR | 97 | 66 | All SZGR 2.0 genes in this pathway |
REACTOME ACTIVATION OF NF KAPPAB IN B CELLS | 64 | 43 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY THE B CELL RECEPTOR BCR | 126 | 90 | All SZGR 2.0 genes in this pathway |
REACTOME TCR SIGNALING | 54 | 46 | All SZGR 2.0 genes in this pathway |
REACTOME DOWNSTREAM TCR SIGNALING | 37 | 32 | All SZGR 2.0 genes in this pathway |
REACTOME P75NTR SIGNALS VIA NFKB | 14 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME NFKB IS ACTIVATED AND SIGNALS SURVIVAL | 11 | 8 | All SZGR 2.0 genes in this pathway |
REACTOME P75 NTR RECEPTOR MEDIATED SIGNALLING | 81 | 61 | All SZGR 2.0 genes in this pathway |
REACTOME TAK1 ACTIVATES NFKB BY PHOSPHORYLATION AND ACTIVATION OF IKKS COMPLEX | 23 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME TRAF6 MEDIATED NFKB ACTIVATION | 21 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME TRAF6 MEDIATED INDUCTION OF NFKB AND MAP KINASES UPON TLR7 8 OR 9 ACTIVATION | 77 | 57 | All SZGR 2.0 genes in this pathway |
REACTOME NFKB AND MAP KINASES ACTIVATION MEDIATED BY TLR4 SIGNALING REPERTOIRE | 72 | 53 | All SZGR 2.0 genes in this pathway |
REACTOME RIG I MDA5 MEDIATED INDUCTION OF IFN ALPHA BETA PATHWAYS | 73 | 57 | All SZGR 2.0 genes in this pathway |
REACTOME MYD88 MAL CASCADE INITIATED ON PLASMA MEMBRANE | 83 | 63 | All SZGR 2.0 genes in this pathway |
REACTOME INNATE IMMUNE SYSTEM | 279 | 178 | All SZGR 2.0 genes in this pathway |
REACTOME ACTIVATED TLR4 SIGNALLING | 93 | 69 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME TOLL RECEPTOR CASCADES | 118 | 84 | All SZGR 2.0 genes in this pathway |
REACTOME ADAPTIVE IMMUNE SYSTEM | 539 | 350 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA UP | 294 | 178 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LIVE UP | 485 | 293 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA UP | 177 | 110 | All SZGR 2.0 genes in this pathway |
BASAKI YBX1 TARGETS UP | 290 | 177 | All SZGR 2.0 genes in this pathway |
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP | 233 | 161 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS UP | 457 | 269 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
HUMMEL BURKITTS LYMPHOMA DN | 15 | 10 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS UP | 214 | 155 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
KOKKINAKIS METHIONINE DEPRIVATION 48HR UP | 128 | 95 | All SZGR 2.0 genes in this pathway |
KOKKINAKIS METHIONINE DEPRIVATION 96HR DN | 75 | 50 | All SZGR 2.0 genes in this pathway |
LAU APOPTOSIS CDKN2A UP | 55 | 40 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS UP | 126 | 72 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
NUNODA RESPONSE TO DASATINIB IMATINIB UP | 29 | 20 | All SZGR 2.0 genes in this pathway |
OLSSON E2F3 TARGETS DN | 49 | 33 | All SZGR 2.0 genes in this pathway |
GILMORE CORE NFKB PATHWAY | 14 | 10 | All SZGR 2.0 genes in this pathway |
SCHEIDEREIT IKK TARGETS | 18 | 15 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 2 | 127 | 92 | All SZGR 2.0 genes in this pathway |
RASHI NFKB1 TARGETS | 19 | 18 | All SZGR 2.0 genes in this pathway |
MARTIN INTERACT WITH HDAC | 44 | 31 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
DIRMEIER LMP1 RESPONSE EARLY | 66 | 48 | All SZGR 2.0 genes in this pathway |
TSAI RESPONSE TO IONIZING RADIATION | 149 | 101 | All SZGR 2.0 genes in this pathway |
PUJANA BREAST CANCER LIT INT NETWORK | 101 | 73 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 DN | 156 | 106 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA HIF1A DN | 110 | 78 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 AND HIF1A UP | 142 | 104 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
LOCKWOOD AMPLIFIED IN LUNG CANCER | 214 | 139 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS DN | 411 | 249 | All SZGR 2.0 genes in this pathway |
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION DN | 206 | 136 | All SZGR 2.0 genes in this pathway |
SHIN B CELL LYMPHOMA CLUSTER 8 | 36 | 28 | All SZGR 2.0 genes in this pathway |
ZHANG RESPONSE TO IKK INHIBITOR AND TNF UP | 223 | 140 | All SZGR 2.0 genes in this pathway |
ZUCCHI METASTASIS DN | 44 | 29 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST UP | 398 | 262 | All SZGR 2.0 genes in this pathway |
YAGI AML RELAPSE PROGNOSIS | 35 | 24 | All SZGR 2.0 genes in this pathway |
GOLUB ALL VS AML DN | 24 | 14 | All SZGR 2.0 genes in this pathway |
SANA TNF SIGNALING UP | 83 | 56 | All SZGR 2.0 genes in this pathway |
GALINDO IMMUNE RESPONSE TO ENTEROTOXIN | 85 | 67 | All SZGR 2.0 genes in this pathway |
NEMETH INFLAMMATORY RESPONSE LPS UP | 88 | 64 | All SZGR 2.0 genes in this pathway |
LENAOUR DENDRITIC CELL MATURATION DN | 128 | 90 | All SZGR 2.0 genes in this pathway |
VERHAAK AML WITH NPM1 MUTATED UP | 183 | 111 | All SZGR 2.0 genes in this pathway |
YAGI AML SURVIVAL | 129 | 87 | All SZGR 2.0 genes in this pathway |
IGLESIAS E2F TARGETS UP | 151 | 103 | All SZGR 2.0 genes in this pathway |
MUNSHI MULTIPLE MYELOMA UP | 81 | 52 | All SZGR 2.0 genes in this pathway |
BASSO CD40 SIGNALING UP | 101 | 76 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP | 314 | 201 | All SZGR 2.0 genes in this pathway |
LEE CALORIE RESTRICTION NEOCORTEX UP | 83 | 66 | All SZGR 2.0 genes in this pathway |
HU GENOTOXIN ACTION DIRECT VS INDIRECT 4HR | 37 | 22 | All SZGR 2.0 genes in this pathway |
ZHOU TNF SIGNALING 4HR | 54 | 36 | All SZGR 2.0 genes in this pathway |
MCDOWELL ACUTE LUNG INJURY UP | 45 | 29 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
NATSUME RESPONSE TO INTERFERON BETA DN | 52 | 33 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL | 254 | 164 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
CHEN LVAD SUPPORT OF FAILING HEART UP | 103 | 69 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN UP | 262 | 186 | All SZGR 2.0 genes in this pathway |
ZHU CMV ALL UP | 120 | 89 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR UP | 178 | 111 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C0 | 107 | 72 | All SZGR 2.0 genes in this pathway |
ZHOU TNF SIGNALING 30MIN | 54 | 36 | All SZGR 2.0 genes in this pathway |
GEISS RESPONSE TO DSRNA UP | 38 | 29 | All SZGR 2.0 genes in this pathway |
ZHU CMV 24 HR UP | 93 | 65 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 24HR UP | 148 | 96 | All SZGR 2.0 genes in this pathway |
HILLION HMGA1 TARGETS | 90 | 71 | All SZGR 2.0 genes in this pathway |
HILLION HMGA1B TARGETS | 92 | 68 | All SZGR 2.0 genes in this pathway |
SARRIO EPITHELIAL MESENCHYMAL TRANSITION DN | 154 | 101 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER DN | 540 | 340 | All SZGR 2.0 genes in this pathway |
MITSIADES RESPONSE TO APLIDIN UP | 439 | 257 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL CULTURED VS FRESH UP | 425 | 298 | All SZGR 2.0 genes in this pathway |
CHEN HOXA5 TARGETS 9HR UP | 223 | 132 | All SZGR 2.0 genes in this pathway |
QI PLASMACYTOMA UP | 259 | 185 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB UP | 245 | 159 | All SZGR 2.0 genes in this pathway |
WANG TUMOR INVASIVENESS UP | 374 | 247 | All SZGR 2.0 genes in this pathway |
VILIMAS NOTCH1 TARGETS UP | 52 | 41 | All SZGR 2.0 genes in this pathway |
SEKI INFLAMMATORY RESPONSE LPS UP | 77 | 56 | All SZGR 2.0 genes in this pathway |
ICHIBA GRAFT VERSUS HOST DISEASE D7 UP | 107 | 67 | All SZGR 2.0 genes in this pathway |
LINDSTEDT DENDRITIC CELL MATURATION B | 53 | 36 | All SZGR 2.0 genes in this pathway |
MARSHALL VIRAL INFECTION RESPONSE DN | 29 | 21 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
HINATA NFKB TARGETS KERATINOCYTE UP | 91 | 63 | All SZGR 2.0 genes in this pathway |
HINATA NFKB TARGETS FIBROBLAST UP | 84 | 60 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER GOOD SURVIVAL A4 | 196 | 124 | All SZGR 2.0 genes in this pathway |
HSIAO HOUSEKEEPING GENES | 389 | 245 | All SZGR 2.0 genes in this pathway |
CROONQUIST STROMAL STIMULATION UP | 60 | 42 | All SZGR 2.0 genes in this pathway |
CROONQUIST NRAS VS STROMAL STIMULATION DN | 99 | 65 | All SZGR 2.0 genes in this pathway |
COULOUARN TEMPORAL TGFB1 SIGNATURE DN | 138 | 99 | All SZGR 2.0 genes in this pathway |
SCHOEN NFKB SIGNALING | 34 | 26 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SUBCLASS S3 | 266 | 180 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA CLASSES DN | 210 | 141 | All SZGR 2.0 genes in this pathway |
DORN ADENOVIRUS INFECTION 12HR DN | 33 | 25 | All SZGR 2.0 genes in this pathway |
DORN ADENOVIRUS INFECTION 24HR DN | 43 | 32 | All SZGR 2.0 genes in this pathway |
DORN ADENOVIRUS INFECTION 32HR DN | 39 | 28 | All SZGR 2.0 genes in this pathway |
DORN ADENOVIRUS INFECTION 48HR DN | 40 | 29 | All SZGR 2.0 genes in this pathway |
TIAN TNF SIGNALING VIA NFKB | 28 | 21 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 3 | 15 | 7 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 2HR UP | 39 | 30 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
WANG TNF TARGETS | 24 | 17 | All SZGR 2.0 genes in this pathway |
KASLER HDAC7 TARGETS 2 DN | 32 | 23 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
PHONG TNF TARGETS UP | 63 | 43 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE NOT VIA P38 | 337 | 236 | All SZGR 2.0 genes in this pathway |
ALTEMEIER RESPONSE TO LPS WITH MECHANICAL VENTILATION | 128 | 81 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-381 | 27 | 34 | 1A,m8 | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-493-5p | 37 | 43 | 1A | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.