Gene Page: SYCP3
Summary ?
GeneID | 50511 |
Symbol | SYCP3 |
Synonyms | COR1|RPRGL4|SCP3|SPGF4 |
Description | synaptonemal complex protein 3 |
Reference | MIM:604759|HGNC:HGNC:18130|Ensembl:ENSG00000139351|HPRD:07265|Vega:OTTHUMG00000150132 |
Gene type | protein-coding |
Map location | 12q |
Pascal p-value | 0.511 |
Fetal beta | 1.241 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg09676606 | 12 | 102132872 | SYCP3 | 2.894E-4 | 0.386 | 0.039 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](/SZGR/GeneImg/SYCP3_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003677 | DNA binding | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007130 | synaptonemal complex assembly | IEA | Synap (GO term level: 11) | - |
GO:0000705 | achiasmate meiosis I | IEA | - | |
GO:0007141 | male meiosis I | NAS | 15218256 | |
GO:0007283 | spermatogenesis | IEA | - | |
GO:0007049 | cell cycle | IEA | - | |
GO:0007066 | female meiosis sister chromatid cohesion | IEA | - | |
GO:0007067 | mitosis | IEA | - | |
GO:0007126 | meiosis | IEA | - | |
GO:0043066 | negative regulation of apoptosis | IEA | - | |
GO:0051301 | cell division | IEA | - | |
GO:0035093 | spermatogenesis, exchange of chromosomal proteins | IMP | 14643120 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000793 | condensed chromosome | IEA | - | |
GO:0000800 | lateral element | IEA | - | |
GO:0000802 | transverse filament | IEA | - | |
GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME MEIOSIS | 116 | 81 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CYCLE | 421 | 253 | All SZGR 2.0 genes in this pathway |
REACTOME CHROMOSOME MAINTENANCE | 122 | 80 | All SZGR 2.0 genes in this pathway |
REACTOME MEIOTIC SYNAPSIS | 73 | 57 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP | 552 | 347 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION UP | 211 | 136 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL | 254 | 164 | All SZGR 2.0 genes in this pathway |
YAMAZAKI TCEB3 TARGETS DN | 215 | 132 | All SZGR 2.0 genes in this pathway |
MATZUK MEIOTIC AND DNA REPAIR | 39 | 26 | All SZGR 2.0 genes in this pathway |
MATZUK SPERMATOCYTE | 72 | 55 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3 UNMETHYLATED | 37 | 21 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3 UNMETHYLATED | 228 | 119 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS DN | 553 | 343 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-26 | 19 | 25 | 1A | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.