SZGR2

Summary ?

GeneID	5058
Symbol	PAK1
Synonyms	PAKalpha
Description	p21 protein (Cdc42/Rac)-activated kinase 1
Reference	MIM:602590\|HGNC:HGNC:8590\|Ensembl:ENSG00000149269\|HPRD:03995\|Vega:OTTHUMG00000165138
Gene type	protein-coding
Map location	11q13.5-q14.1
Pascal p-value	0.977
Fetal beta	-1.603
eGene	Myers' cis & trans
Support	G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 4
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.6755

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs6902183	chr6	121963786	PAK1	5058		0.17		trans
rs7132043	chr12	80968399	PAK1	5058		0.12		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
RARB	0.93	0.48
EBF1	0.93	0.41
IKZF1	0.92	0.52
ZNF521	0.91	0.61
C10orf41	0.91	0.33
DLX6	0.90	0.54
PDYN	0.89	0.35
TSPAN9	0.88	0.56
GPR149	0.88	0.53
NTN1	0.88	0.44

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
CHPT1	-0.24	-0.25
PTH1R	-0.23	-0.35
C5orf53	-0.22	-0.33
AF347015.31	-0.22	-0.49
COPZ2	-0.22	-0.41
RTN4RL2	-0.22	0.06
COX4I2	-0.22	-0.45
C1S	-0.22	-0.02
MUSTN1	-0.22	-0.38
CA4	-0.22	-0.33

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0005515	protein binding	IPI		12624090 \|12879077 \|15350535 \|16278681 \|18086875
GO:0005524	ATP binding	IEA		-
GO:0004674	protein serine/threonine kinase activity	TAS		16278681
GO:0016740	transferase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007528	neuromuscular junction development	IEA	Synap (GO term level: 10)	-
GO:0016358	dendrite development	IEA	neurite, dendrite (GO term level: 11)	-
GO:0000165	MAPKKK cascade	IDA		8805275
GO:0007010	cytoskeleton organization	TAS		16278681
GO:0006984	ER-nuclear signaling pathway	TAS		16278681
GO:0006915	apoptosis	IEA		-
GO:0043507	positive regulation of JNK activity	IMP		8805275
GO:0043113	receptor clustering	IEA		-
GO:0046777	protein amino acid autophosphorylation	IDA		8805275
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0030426	growth cone	IEA	axon, dendrite (GO term level: 5)	-
GO:0030424	axon	IEA	neuron, axon, Neurotransmitter (GO term level: 6)	-
GO:0005794	Golgi apparatus	IDA		18029348
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IDA		16278681
GO:0005886	plasma membrane	IDA		16278681
GO:0030054	cell junction	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ABI3	NESH \| SSH3BP3	ABI family, member 3	-	HPRD,BioGRID	11956071
AKT1	AKT \| MGC99656 \| PKB \| PKB-ALPHA \| PRKBA \| RAC \| RAC-ALPHA	v-akt murine thymoma viral oncogene homolog 1	Reconstituted Complex	BioGRID	14749719
ARHGDIA	GDIA1 \| MGC117248 \| RHOGDI \| RHOGDI-1	Rho GDP dissociation inhibitor (GDI) alpha	Pak1 interacts with and phosphorylates RhoGDI. This interaction was modeled on a demonstrated interaction between Pak1 from an unspecified species and human RhoGDI.	BIND	15225553
ARHGEF2	DKFZp547L106 \| DKFZp547P1516 \| GEF \| GEF-H1 \| GEFH1 \| KIAA0651 \| LFP40 \| P40	rho/rac guanine nucleotide exchange factor (GEF) 2	Affinity Capture-MS Reconstituted Complex	BioGRID	14970201
ARHGEF6	COOL2 \| Cool-2 \| KIAA0006 \| MRX46 \| PIXA \| alpha-PIX \| alphaPIX	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	-	HPRD,BioGRID	9659915
ARHGEF7	BETA-PIX \| COOL1 \| DKFZp686C12170 \| DKFZp761K1021 \| KIAA0142 \| KIAA0412 \| Nbla10314 \| P50 \| P50BP \| P85 \| P85COOL1 \| P85SPR \| PAK3 \| PIXB	Rho guanine nucleotide exchange factor (GEF) 7	-	HPRD,BioGRID	11157752\|12006652
ARPC1B	ARC41 \| p40-ARC \| p41-ARC	actin related protein 2/3 complex, subunit 1B, 41kDa	-	HPRD,BioGRID	14749719
BAIAP2	BAP2 \| IRSP53	BAI1-associated protein 2	Reconstituted Complex	BioGRID	11130076
BMX	ETK \| PSCTK2 \| PSCTK3	BMX non-receptor tyrosine kinase	-	HPRD,BioGRID	11382770
CDC2L2	CDC2L3 \| CDK11-p110 \| CDK11-p46 \| CDK11-p58 \| MGC131975 \| PITSLRE \| p58GTA	cell division cycle 2-like 2 (PITSLRE proteins)	-	HPRD,BioGRID	12624090
CDC42	CDC42Hs \| G25K	cell division cycle 42 (GTP binding protein, 25kDa)	Reconstituted Complex	BioGRID	12650940
CDC42	CDC42Hs \| G25K	cell division cycle 42 (GTP binding protein, 25kDa)	PAK1 interacts with an unspecified isoform of Cdc42. This interaction was modeled on a demonstrated interaction between PAK1 from an unspecified species and human Cdc42.	BIND	15864311
CDC42	CDC42Hs \| G25K	cell division cycle 42 (GTP binding protein, 25kDa)	-	HPRD	7744004 \|8107774 \|9705280\|9705280
CDC42	CDC42Hs \| G25K	cell division cycle 42 (GTP binding protein, 25kDa)	Cdc42 interacts with Pak1. This interaction was modelled on a demonstrated interaction between Cdc42 from an unspecified species and human Pak1.	BIND	12944407
CDK5	PSSALRE	cyclin-dependent kinase 5	Affinity Capture-Western Biochemical Activity	BioGRID	11604394
CDK5R1	CDK5P35 \| CDK5R \| MGC33831 \| NCK5A \| p23 \| p25 \| p35 \| p35nck5a	cyclin-dependent kinase 5, regulatory subunit 1 (p35)	-	HPRD	11604394
COL1A1	OI4	collagen, type I, alpha 1	-	HPRD,BioGRID	10772928
CSNK2A1	CK2A1 \| CKII	casein kinase 2, alpha 1 polypeptide	-	HPRD	10938077
CSNK2A2	CK2A2 \| CSNK2A1 \| FLJ43934	casein kinase 2, alpha prime polypeptide	-	HPRD	10938077
DYNLL1	DLC1 \| DLC8 \| DNCL1 \| DNCLC1 \| LC8 \| LC8a \| MGC126137 \| MGC126138 \| PIN \| hdlc1	dynein, light chain, LC8-type 1	Affinity Capture-Western Biochemical Activity Reconstituted Complex Two-hybrid	BioGRID	15193260
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	Tyrosine-phosphorylated EGFR interacts with PAK1.	BIND	12522133
ERBB2	CD340 \| HER-2 \| HER-2/neu \| HER2 \| NEU \| NGL \| TKR1	v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)	-	HPRD,BioGRID	9774445
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	PAK1 interacts with Grb2.	BIND	12522133
HGS	HRS \| ZFYVE8	hepatocyte growth factor-regulated tyrosine kinase substrate	-	HPRD,BioGRID	11397816
HIST4H4	H4/p \| MGC24116	histone cluster 4, H4	PAK1 phosphorylates H4. This interaction was modeled on a demonstrated interaction between human PAK1 and H4 from an unspecified species.	BIND	15864311
LIMK1	LIMK	LIM domain kinase 1	-	HPRD,BioGRID	10559936
MYLK	DKFZp686I10125 \| FLJ12216 \| KRP \| MLCK \| MLCK1 \| MLCK108 \| MLCK210 \| MSTP083 \| MYLK1 \| smMLCK	myosin light chain kinase	-	HPRD,BioGRID	10092231
NCF1C	SH3PXD1C	neutrophil cytosolic factor 1C pseudogene	Pak1 interacts with and phosphorylates P47. This interaction was modeled on a demonstrated interaction between Pak1 and P47 from unspecified species.	BIND	15225553
NCK1	MGC12668 \| NCK \| NCKalpha	NCK adaptor protein 1	-	HPRD	8824201 \|11278241
NCK1	MGC12668 \| NCK \| NCKalpha	NCK adaptor protein 1	Nck interacts with PAK1	BIND	8824201
NCK1	MGC12668 \| NCK \| NCKalpha	NCK adaptor protein 1	-	HPRD,BioGRID	8824201
NCK2	GRB4 \| NCKbeta	NCK adaptor protein 2	-	HPRD,BioGRID	10026169 \|11557983
NF2	ACN \| BANF \| SCH	neurofibromin 2 (merlin)	Merlin interacts with Pak1	BIND	14580336
NF2	ACN \| BANF \| SCH	neurofibromin 2 (merlin)	-	HPRD	14580336
PAK1	MGC130000 \| MGC130001 \| PAKalpha	p21 protein (Cdc42/Rac)-activated kinase 1	-	HPRD,BioGRID	11804587
PAK1IP1	FLJ20624 \| MAK11 \| PIP1 \| RP11-421M1.5 \| WDR84 \| bA421M1.5 \| hPIP1	PAK1 interacting protein 1	-	HPRD,BioGRID	11371639
PKLR	PK1 \| PKL \| PKR \| PKRL \| RPK	pyruvate kinase, liver and RBC	Affinity Capture-Western	BioGRID	12006652
PLCG1	PLC-II \| PLC1 \| PLC148 \| PLCgamma1	phospholipase C, gamma 1	-	HPRD,BioGRID	12085993
PPM1F	CaMKPase \| FEM-2 \| KIAA0015 \| POPX2 \| hFEM-2	protein phosphatase 1F (PP2C domain containing)	-	HPRD	11864573
PXN	FLJ16691	paxillin	-	HPRD	10330411
RAC1	MGC111543 \| MIG5 \| TC-25 \| p21-Rac1	ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)	PAK1 interacts with an unspecified isoform of Rac. This interaction was modeled on a demonstrated interaction between human PAK1 and Rac from Chinese hamster.	BIND	15975516
RAC1	MGC111543 \| MIG5 \| TC-25 \| p21-Rac1	ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)	PAK1 interacts with an unspecified isoform of Rac. This interaction was modeled on a demonstrated interaction between PAK1 from an unspecified species and human Rac.	BIND	15864311
RAC1	MGC111543 \| MIG5 \| TC-25 \| p21-Rac1	ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)	-	HPRD	7744004 \|8107774 \|11134022 \|11950930\|11134022
RAC1	MGC111543 \| MIG5 \| TC-25 \| p21-Rac1	ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)	Reconstituted Complex	BioGRID	12650940 \|12879077
RAC1	MGC111543 \| MIG5 \| TC-25 \| p21-Rac1	ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)	Active GTP-bound RAC1 interacts with PAK1B. This interaction was modelled on a demonstrated interaction between chicken RAC1 and human PAK1B.	BIND	15735674
RAC1	MGC111543 \| MIG5 \| TC-25 \| p21-Rac1	ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)	Rac1 interacts with Pak1. This interaction was modeled on a demonstrated interaction between Rac1 and Pak1 from an unspecified species.	BIND	15652748
RAC1	MGC111543 \| MIG5 \| TC-25 \| p21-Rac1	ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)	Rac1 interacts with Pak1. This interaction was modelled on a demonstrated interacton between Rac1 from an unspecified species and human Pak1.	BIND	12944407
RAF1	CRAF \| NS5 \| Raf-1 \| c-Raf	v-raf-1 murine leukemia viral oncogene homolog 1	-	HPRD,BioGRID	11733498
RHOJ	ARHJ \| FLJ14445 \| MGC34777 \| RASL7B \| TC10B \| TCL	ras homolog gene family, member J	-	HPRD,BioGRID	10967094
RHOU	ARHU \| CDC42L1 \| DJ646B12.2 \| FLJ10616 \| WRCH1 \| fJ646B12.2 \| hG28K	ras homolog gene family, member U	Wrch-1 interacts with PAK. This interaction was modeled on a demonstrated interactions between human Wrch-1 and rat PAK.	BIND	15556869
SPEN	KIAA0929 \| MINT \| RP1-134O19.1 \| SHARP	spen homolog, transcriptional regulator (Drosophila)	Pak1 phosphorylates SHARP. This interaction was modeled on a demonstrated interaction between Pak1 and SHARP both from an unspecified species.	BIND	15824732
TGFBR2	AAT3 \| FAA3 \| LDS1B \| LDS2B \| MFS2 \| RIIC \| TAAD2 \| TGFR-2 \| TGFbeta-RII	transforming growth factor, beta receptor II (70/80kDa)	T-beta-RII interacts with PAK1. This interaction was modeled on a demonstrated interaction between human T-beta-RII and mouse PAK1.	BIND	15761153

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
KEGG ERBB SIGNALING PATHWAY	87	71	All SZGR 2.0 genes in this pathway
KEGG CHEMOKINE SIGNALING PATHWAY	190	128	All SZGR 2.0 genes in this pathway
KEGG AXON GUIDANCE	129	103	All SZGR 2.0 genes in this pathway
KEGG FOCAL ADHESION	201	138	All SZGR 2.0 genes in this pathway
KEGG NATURAL KILLER CELL MEDIATED CYTOTOXICITY	137	92	All SZGR 2.0 genes in this pathway
KEGG T CELL RECEPTOR SIGNALING PATHWAY	108	89	All SZGR 2.0 genes in this pathway
KEGG FC GAMMA R MEDIATED PHAGOCYTOSIS	97	71	All SZGR 2.0 genes in this pathway
KEGG REGULATION OF ACTIN CYTOSKELETON	216	144	All SZGR 2.0 genes in this pathway
KEGG EPITHELIAL CELL SIGNALING IN HELICOBACTER PYLORI INFECTION	68	44	All SZGR 2.0 genes in this pathway
KEGG RENAL CELL CARCINOMA	70	60	All SZGR 2.0 genes in this pathway
BIOCARTA AGR PATHWAY	36	31	All SZGR 2.0 genes in this pathway
BIOCARTA AT1R PATHWAY	36	28	All SZGR 2.0 genes in this pathway
BIOCARTA FAS PATHWAY	30	22	All SZGR 2.0 genes in this pathway
BIOCARTA FMLP PATHWAY	39	29	All SZGR 2.0 genes in this pathway
BIOCARTA RACCYCD PATHWAY	26	23	All SZGR 2.0 genes in this pathway
BIOCARTA PYK2 PATHWAY	31	24	All SZGR 2.0 genes in this pathway
BIOCARTA MAPK PATHWAY	87	68	All SZGR 2.0 genes in this pathway
BIOCARTA RAC1 PATHWAY	23	16	All SZGR 2.0 genes in this pathway
BIOCARTA NKCELLS PATHWAY	20	13	All SZGR 2.0 genes in this pathway
BIOCARTA CDC42RAC PATHWAY	16	13	All SZGR 2.0 genes in this pathway
BIOCARTA MET PATHWAY	37	30	All SZGR 2.0 genes in this pathway
BIOCARTA TNFR1 PATHWAY	29	21	All SZGR 2.0 genes in this pathway
SIG PIP3 SIGNALING IN CARDIAC MYOCTES	67	54	All SZGR 2.0 genes in this pathway
SIG CHEMOTAXIS	45	37	All SZGR 2.0 genes in this pathway
SIG REGULATION OF THE ACTIN CYTOSKELETON BY RHO GTPASES	35	25	All SZGR 2.0 genes in this pathway
ST INTEGRIN SIGNALING PATHWAY	82	62	All SZGR 2.0 genes in this pathway
ST T CELL SIGNAL TRANSDUCTION	45	33	All SZGR 2.0 genes in this pathway
PID MET PATHWAY	80	60	All SZGR 2.0 genes in this pathway
PID EPHB FWD PATHWAY	40	38	All SZGR 2.0 genes in this pathway
PID P38 ALPHA BETA PATHWAY	31	25	All SZGR 2.0 genes in this pathway
PID CDC42 PATHWAY	70	51	All SZGR 2.0 genes in this pathway
PID ANGIOPOIETIN RECEPTOR PATHWAY	50	41	All SZGR 2.0 genes in this pathway
PID NETRIN PATHWAY	32	27	All SZGR 2.0 genes in this pathway
PID CXCR4 PATHWAY	102	78	All SZGR 2.0 genes in this pathway
PID ERBB1 RECEPTOR PROXIMAL PATHWAY	35	29	All SZGR 2.0 genes in this pathway
PID PLK1 PATHWAY	46	25	All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY	129	103	All SZGR 2.0 genes in this pathway
PID AURORA A PATHWAY	31	20	All SZGR 2.0 genes in this pathway
PID S1P S1P2 PATHWAY	24	19	All SZGR 2.0 genes in this pathway
PID EPHA2 FWD PATHWAY	19	16	All SZGR 2.0 genes in this pathway
PID RAC1 PATHWAY	54	37	All SZGR 2.0 genes in this pathway
PID FAK PATHWAY	59	45	All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME CELL CELL COMMUNICATION	120	77	All SZGR 2.0 genes in this pathway
REACTOME TCR SIGNALING	54	46	All SZGR 2.0 genes in this pathway
REACTOME GENERATION OF SECOND MESSENGER MOLECULES	27	25	All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE	251	188	All SZGR 2.0 genes in this pathway
REACTOME CD28 CO STIMULATION	32	26	All SZGR 2.0 genes in this pathway
REACTOME ACTIVATION OF RAC	14	11	All SZGR 2.0 genes in this pathway
REACTOME SEMA3A PAK DEPENDENT AXON REPULSION	15	14	All SZGR 2.0 genes in this pathway
REACTOME CD28 DEPENDENT VAV1 PATHWAY	11	10	All SZGR 2.0 genes in this pathway
REACTOME SEMAPHORIN INTERACTIONS	68	53	All SZGR 2.0 genes in this pathway
REACTOME COSTIMULATION BY THE CD28 FAMILY	63	48	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ROBO RECEPTOR	30	26	All SZGR 2.0 genes in this pathway
REACTOME L1CAM INTERACTIONS	86	62	All SZGR 2.0 genes in this pathway
REACTOME SIGNAL TRANSDUCTION BY L1	34	25	All SZGR 2.0 genes in this pathway
REACTOME DSCAM INTERACTIONS	11	10	All SZGR 2.0 genes in this pathway
REACTOME IMMUNE SYSTEM	933	616	All SZGR 2.0 genes in this pathway
REACTOME ADAPTIVE IMMUNE SYSTEM	539	350	All SZGR 2.0 genes in this pathway
HUTTMANN B CLL POOR SURVIVAL UP	276	187	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN	805	505	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
CHIN BREAST CANCER COPY NUMBER UP	27	18	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN	800	473	All SZGR 2.0 genes in this pathway
SNIJDERS AMPLIFIED IN HEAD AND NECK TUMORS	37	27	All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER	747	453	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN	164	111	All SZGR 2.0 genes in this pathway
OXFORD RALA OR RALB TARGETS DN	24	17	All SZGR 2.0 genes in this pathway
BENPORATH ES 1	379	235	All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS	290	172	All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS	734	436	All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION DN	517	309	All SZGR 2.0 genes in this pathway
LEE TARGETS OF PTCH1 AND SUFU DN	83	69	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 11Q12 Q14 AMPLICON	158	93	All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION	475	313	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA HP UP	49	26	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR	532	309	All SZGR 2.0 genes in this pathway
LU AGING BRAIN DN	153	120	All SZGR 2.0 genes in this pathway
VERRECCHIA RESPONSE TO TGFB1 C1	19	15	All SZGR 2.0 genes in this pathway
VERRECCHIA EARLY RESPONSE TO TGFB1	58	43	All SZGR 2.0 genes in this pathway
WU HBX TARGETS 3 DN	13	9	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX DN	88	58	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
DURCHDEWALD SKIN CARCINOGENESIS DN	264	168	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3	720	440	All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6	469	239	All SZGR 2.0 genes in this pathway
MCCABE HOXC6 TARGETS DN	21	15	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP	973	570	All SZGR 2.0 genes in this pathway
CLIMENT BREAST CANCER COPY NUMBER UP	23	20	All SZGR 2.0 genes in this pathway
MUELLER PLURINET	299	189	All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS UP	374	247	All SZGR 2.0 genes in this pathway
RAY TARGETS OF P210 BCR ABL FUSION DN	16	11	All SZGR 2.0 genes in this pathway
WALLACE JAK2 TARGETS UP	26	15	All SZGR 2.0 genes in this pathway
LEE RECENT THYMIC EMIGRANT	227	128	All SZGR 2.0 genes in this pathway
ONO AML1 TARGETS UP	24	14	All SZGR 2.0 genes in this pathway
ONO FOXP3 TARGETS UP	23	15	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S1	237	159	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN	306	191	All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3	718	401	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 1HR DN	222	147	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP	548	370	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT	567	365	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN	321	200	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
KATSANOU ELAVL1 TARGETS DN	148	88	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL DN	428	246	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway
CHEMELLO SOLEUS VS EDL MYOFIBERS DN	19	10	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	1089	1095	m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-150	554	560	1A	hsa-miR-150	UCUCCCAACCCUUGUACCAGUG
miR-221/222	659	666	1A,m8	hsa-miR-221^brain	AGCUACAUUGUCUGCUGGGUUUC
miR-221/222	659	666	1A,m8	hsa-miR-222^brain	AGCUACAUCUGGCUACUGGGUCUC
miR-34b	1202	1208	m8	hsa-miR-34b	UAGGCAGUGUCAUUAGCUGAUUG
miR-376c	657	663	1A	hsa-miR-376c	AACAUAGAGGAAAUUCCACG
miR-485-5p	15	22	1A,m8	hsa-miR-485-5p	AGAGGCUGGCCGUGAUGAAUUC
miR-96	25	31	m8	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PAK1