Gene Page: LEF1
Summary ?
GeneID | 51176 |
Symbol | LEF1 |
Synonyms | LEF-1|TCF10|TCF1ALPHA|TCF7L3 |
Description | lymphoid enhancer binding factor 1 |
Reference | MIM:153245|HGNC:HGNC:6551|Ensembl:ENSG00000138795|HPRD:01075|Vega:OTTHUMG00000131809 |
Gene type | protein-coding |
Map location | 4q25 |
Pascal p-value | 0.166 |
Fetal beta | -0.823 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenics,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg19737633 | 4 | 109087912 | LOC641518;LEF1 | 1.177E-4 | -0.381 | 0.029 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003677 | DNA binding | IEA | - | |
GO:0003682 | chromatin binding | IEA | - | |
GO:0003705 | RNA polymerase II transcription factor activity, enhancer binding | IEA | - | |
GO:0005515 | protein binding | IPI | 9751710 |12192039 | |
GO:0008301 | DNA bending activity | ISS | - | |
GO:0016563 | transcription activator activity | IEA | - | |
GO:0043565 | sequence-specific DNA binding | IDA | 9308964 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0021542 | dentate gyrus development | IEA | neuron (GO term level: 12) | - |
GO:0000122 | negative regulation of transcription from RNA polymerase II promoter | IEA | - | |
GO:0001756 | somitogenesis | IEA | - | |
GO:0001890 | placenta development | IEA | - | |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006350 | transcription | IEA | - | |
GO:0016055 | Wnt receptor signaling pathway | IEA | - | |
GO:0048468 | cell development | IEA | - | |
GO:0030111 | regulation of Wnt receptor signaling pathway | IEA | - | |
GO:0042475 | odontogenesis of dentine-containing tooth | IEA | - | |
GO:0030879 | mammary gland development | IEA | - | |
GO:0030326 | embryonic limb morphogenesis | IEA | - | |
GO:0048341 | paraxial mesoderm formation | IEA | - | |
GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IEA | - | |
GO:0045843 | negative regulation of striated muscle development | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IC | 9308964 | |
GO:0005634 | nucleus | IEA | - | |
GO:0005667 | transcription factor complex | IEA | - | |
GO:0005730 | nucleolus | IDA | 18029348 | |
GO:0005737 | cytoplasm | IDA | 18029348 | |
GO:0005737 | cytoplasm | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ALX4 | FPP | KIAA1788 | PFM | PFM1 | PFM2 | ALX homeobox 4 | - | HPRD,BioGRID | 11696550 |
CTNNB1 | CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 | catenin (cadherin-associated protein), beta 1, 88kDa | - | HPRD | 8757136 |12556497 |
CTNNB1 | CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 | catenin (cadherin-associated protein), beta 1, 88kDa | Affinity Capture-Western Two-hybrid | BioGRID | 8757136 |12748295 |15684397 |
CTNNB1 | CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 | catenin (cadherin-associated protein), beta 1, 88kDa | LEF-1 interacts with Beta-catenin. This interaction was modeled on a demonstrated interaction between human LEF-1 and mouse Beta-catenin. | BIND | 15525529 |
EP300 | KAT3B | p300 | E1A binding protein p300 | - | HPRD,BioGRID | 12446687 |
KPNA1 | IPOA5 | NPI-1 | RCH2 | SRP1 | karyopherin alpha 1 (importin alpha 5) | - | HPRD | 8631802 |
KPNA2 | IPOA1 | QIP2 | RCH1 | SRP1alpha | karyopherin alpha 2 (RAG cohort 1, importin alpha 1) | - | HPRD | 8631802 |
MITF | MI | WS2A | bHLHe32 | microphthalmia-associated transcription factor | - | HPRD,BioGRID | 12032083 |
NLK | DKFZp761G1211 | FLJ21033 | nemo-like kinase | Affinity Capture-Western | BioGRID | 12556497 |
NLK | DKFZp761G1211 | FLJ21033 | nemo-like kinase | - | HPRD | 12901858 |
NOTCH1 | TAN1 | hN1 | Notch homolog 1, translocation-associated (Drosophila) | - | HPRD,BioGRID | 11604490 |
PIAS4 | FLJ12419 | MGC35296 | PIASY | Piasg | ZMIZ6 | protein inhibitor of activated STAT, 4 | - | HPRD,BioGRID | 11731474 |
RUNX1 | AML1 | AML1-EVI-1 | AMLCR1 | CBFA2 | EVI-1 | PEBP2aB | runt-related transcription factor 1 | Reconstituted Complex | BioGRID | 12551949 |
RUNX2 | AML3 | CBFA1 | CCD | CCD1 | MGC120022 | MGC120023 | OSF2 | PEA2aA | PEBP2A1 | PEBP2A2 | PEBP2aA | PEBP2aA1 | runt-related transcription factor 2 | Reconstituted Complex | BioGRID | 12551949 |
RUVBL1 | ECP54 | INO80H | NMP238 | PONTIN | Pontin52 | RVB1 | TIH1 | TIP49 | TIP49A | RuvB-like 1 (E. coli) | Affinity Capture-Western | BioGRID | 9843967 |
SMAD1 | BSP1 | JV4-1 | JV41 | MADH1 | MADR1 | SMAD family member 1 | - | HPRD,BioGRID | 10890911 |
SMAD2 | JV18 | JV18-1 | MADH2 | MADR2 | MGC22139 | MGC34440 | hMAD-2 | hSMAD2 | SMAD family member 2 | - | HPRD,BioGRID | 10890911 |
SMAD3 | DKFZp586N0721 | DKFZp686J10186 | HSPC193 | HsT17436 | JV15-2 | MADH3 | MGC60396 | SMAD family member 3 | Lef1 interacts with Smad3. This interaction was modeled on a demonstrated interaction between mouse Lef1 and Smad3 from an unspecified species. | BIND | 15750622 |
SMAD3 | DKFZp586N0721 | DKFZp686J10186 | HSPC193 | HsT17436 | JV15-2 | MADH3 | MGC60396 | SMAD family member 3 | - | HPRD,BioGRID | 10890911 |
SMAD4 | DPC4 | JIP | MADH4 | SMAD family member 4 | - | HPRD,BioGRID | 10890911 |
SMAD7 | CRCS3 | FLJ16482 | MADH7 | MADH8 | SMAD family member 7 | Affinity Capture-Western | BioGRID | 15684397 |
THOC4 | ALY | BEF | THO complex 4 | Reconstituted Complex | BioGRID | 9119228 |
TLE1 | ESG | ESG1 | GRG1 | transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) | - | HPRD,BioGRID | 9751710 |
TLE1 | ESG | ESG1 | GRG1 | transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) | LEF-1 interacts with TLE1. This interaction was modeled on a demonstrated interaction between LEF-1 from an unspecified species and human TLE1. | BIND | 9751710 |
TRA@ | FLJ22602 | MGC117436 | MGC22624 | MGC23964 | MGC71411 | TCRA | TCRD | TRA | T cell receptor alpha locus | - | HPRD | 1827423 |9119227|9119227 |
UBTF | NOR-90 | UBF | upstream binding transcription factor, RNA polymerase I | - | HPRD,BioGRID | 12748295 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG WNT SIGNALING PATHWAY | 151 | 112 | All SZGR 2.0 genes in this pathway |
KEGG ADHERENS JUNCTION | 75 | 53 | All SZGR 2.0 genes in this pathway |
KEGG MELANOGENESIS | 102 | 80 | All SZGR 2.0 genes in this pathway |
KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
KEGG COLORECTAL CANCER | 62 | 47 | All SZGR 2.0 genes in this pathway |
KEGG ENDOMETRIAL CANCER | 52 | 45 | All SZGR 2.0 genes in this pathway |
KEGG PROSTATE CANCER | 89 | 75 | All SZGR 2.0 genes in this pathway |
KEGG THYROID CANCER | 29 | 26 | All SZGR 2.0 genes in this pathway |
KEGG BASAL CELL CARCINOMA | 55 | 44 | All SZGR 2.0 genes in this pathway |
KEGG ACUTE MYELOID LEUKEMIA | 60 | 47 | All SZGR 2.0 genes in this pathway |
KEGG ARRHYTHMOGENIC RIGHT VENTRICULAR CARDIOMYOPATHY ARVC | 76 | 59 | All SZGR 2.0 genes in this pathway |
BIOCARTA GSK3 PATHWAY | 27 | 26 | All SZGR 2.0 genes in this pathway |
BIOCARTA PITX2 PATHWAY | 15 | 15 | All SZGR 2.0 genes in this pathway |
BIOCARTA WNT PATHWAY | 26 | 24 | All SZGR 2.0 genes in this pathway |
WNT SIGNALING | 89 | 71 | All SZGR 2.0 genes in this pathway |
PID CMYB PATHWAY | 84 | 61 | All SZGR 2.0 genes in this pathway |
PID BETA CATENIN NUC PATHWAY | 80 | 60 | All SZGR 2.0 genes in this pathway |
HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
LIU SOX4 TARGETS UP | 137 | 94 | All SZGR 2.0 genes in this pathway |
RODRIGUES NTN1 TARGETS UP | 17 | 11 | All SZGR 2.0 genes in this pathway |
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP | 233 | 161 | All SZGR 2.0 genes in this pathway |
HUMMEL BURKITTS LYMPHOMA UP | 43 | 27 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LPS UP | 431 | 237 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS UP | 214 | 155 | All SZGR 2.0 genes in this pathway |
JAATINEN HEMATOPOIETIC STEM CELL DN | 226 | 132 | All SZGR 2.0 genes in this pathway |
KOKKINAKIS METHIONINE DEPRIVATION 48HR DN | 64 | 39 | All SZGR 2.0 genes in this pathway |
KOKKINAKIS METHIONINE DEPRIVATION 96HR DN | 75 | 50 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN 2FC DN | 21 | 13 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA2 PCC NETWORK | 423 | 265 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS MODERATELY UP | 109 | 69 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS UP | 292 | 168 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
MORI PRE BI LYMPHOCYTE UP | 80 | 54 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
PARK HSC MARKERS | 44 | 31 | All SZGR 2.0 genes in this pathway |
HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
HADDAD T LYMPHOCYTE AND NK PROGENITOR DN | 63 | 41 | All SZGR 2.0 genes in this pathway |
KUMAR TARGETS OF MLL AF9 FUSION | 405 | 264 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP | 390 | 242 | All SZGR 2.0 genes in this pathway |
HU GENOTOXIN ACTION DIRECT VS INDIRECT 24HR | 55 | 38 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 14HR UP | 156 | 101 | All SZGR 2.0 genes in this pathway |
ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
ZHENG FOXP3 TARGETS IN T LYMPHOCYTE DN | 37 | 29 | All SZGR 2.0 genes in this pathway |
SANSOM WNT PATHWAY REQUIRE MYC | 58 | 43 | All SZGR 2.0 genes in this pathway |
KONDO PROSTATE CANCER HCP WITH H3K27ME3 | 97 | 72 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
NADELLA PRKAR1A TARGETS DN | 8 | 8 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
MCGARVEY SILENCED BY METHYLATION IN COLON CANCER | 42 | 29 | All SZGR 2.0 genes in this pathway |
GU PDEF TARGETS UP | 71 | 49 | All SZGR 2.0 genes in this pathway |
RUIZ TNC TARGETS UP | 153 | 107 | All SZGR 2.0 genes in this pathway |
LEE DIFFERENTIATING T LYMPHOCYTE | 200 | 115 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS UP | 395 | 249 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G6 UP | 65 | 43 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA UP | 207 | 143 | All SZGR 2.0 genes in this pathway |
GUTIERREZ CHRONIC LYMPHOCYTIC LEUKEMIA DN | 56 | 39 | All SZGR 2.0 genes in this pathway |
NAKAYAMA SOFT TISSUE TUMORS PCA2 UP | 87 | 50 | All SZGR 2.0 genes in this pathway |
KASLER HDAC7 TARGETS 1 UP | 194 | 133 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-26 | 978 | 984 | 1A | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-34/449 | 190 | 197 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-363 | 31 | 38 | 1A,m8 | hsa-miR-363 | AUUGCACGGUAUCCAUCUGUAA |
miR-381 | 612 | 619 | 1A,m8 | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-505 | 81 | 87 | 1A | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
miR-93.hd/291-3p/294/295/302/372/373/520 | 975 | 981 | m8 | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.