Gene Page: TPPP3

Summary ?
GeneID51673
SymbolTPPP3
SynonymsCGI-38|TPPP/p20|p20|p25gamma
Descriptiontubulin polymerization-promoting protein family member 3
ReferenceHGNC:HGNC:24162|Ensembl:ENSG00000159713|HPRD:16710|Vega:OTTHUMG00000137516
Gene typeprotein-coding
Map location16q22.1
Pascal p-value9.145E-4
Sherlock p-value0.459
Fetal beta-1.631
DMG1 (# studies)

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Jaffe_2016Genome-wide DNA methylation analysisThis dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg130672151667427285TPPP32.95E-10-0.0276.67E-7DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
SENGUPTA NASOPHARYNGEAL CARCINOMA DN 349157All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN 12686All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 DN 162116All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821933All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN 508354All SZGR 2.0 genes in this pathway
JAZAG TGFB1 SIGNALING VIA SMAD4 UP 10866All SZGR 2.0 genes in this pathway
HATADA METHYLATED IN LUNG CANCER UP 390236All SZGR 2.0 genes in this pathway
INGRAM SHH TARGETS DN 6441All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038678All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062725All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118744All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652441All SZGR 2.0 genes in this pathway
SHEPARD BMYB MORPHOLINO UP 205126All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA UP 9864All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR 681420All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566371All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 473224All SZGR 2.0 genes in this pathway
LEIN OLIGODENDROCYTE MARKERS 7453All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B UP 172109All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN 701446All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH DN 3125All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER BRCA1 DN 4428All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 9 3526All SZGR 2.0 genes in this pathway
MIKKELSEN IPS ICP WITH H3K4ME3 AND H327ME3 12683All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 718401All SZGR 2.0 genes in this pathway
MARTENS BOUND BY PML RARA FUSION 456287All SZGR 2.0 genes in this pathway
VANDESLUIS COMMD1 TARGETS GROUP 4 DN 1611All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725838All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-15/16/195/424/497304310m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU