Gene Page: SEPT4
Summary ?
GeneID | 5414 |
Symbol | SEPT4 |
Synonyms | ARTS|BRADEION|CE5B3|H5|MART|PNUTL2|SEP4|hCDCREL-2|hucep-7 |
Description | septin 4 |
Reference | MIM:603696|HGNC:HGNC:9165|Ensembl:ENSG00000108387|HPRD:04738|Vega:OTTHUMG00000179243 |
Gene type | protein-coding |
Map location | 17q22 |
Pascal p-value | 6.625E-4 |
Sherlock p-value | 0.522 |
eGene | Putamen basal ganglia |
Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs34704261 | 17 | 56353429 | SEPT4 | ENSG00000108387.10 | 1.54396E-6 | 0.02 | 264750 | gtex_brain_putamen_basal |
rs117369354 | 17 | 56371332 | SEPT4 | ENSG00000108387.10 | 3.39794E-6 | 0.02 | 246847 | gtex_brain_putamen_basal |
rs75751534 | 17 | 56377870 | SEPT4 | ENSG00000108387.10 | 3.73691E-6 | 0.02 | 240309 | gtex_brain_putamen_basal |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
RARRES3 | 0.80 | 0.79 |
SDS | 0.79 | 0.73 |
MGST1 | 0.79 | 0.78 |
AGXT2L1 | 0.79 | 0.75 |
MT1X | 0.78 | 0.75 |
IL17RB | 0.78 | 0.62 |
NQO1 | 0.78 | 0.78 |
SCRG1 | 0.75 | 0.77 |
SAT1 | 0.75 | 0.73 |
TAPBPL | 0.75 | 0.73 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MKL1 | -0.51 | -0.69 |
SPTAN1 | -0.51 | -0.72 |
UBE2O | -0.51 | -0.65 |
GTF2F1 | -0.51 | -0.72 |
MYO18A | -0.51 | -0.63 |
USP7 | -0.51 | -0.68 |
KIF3C | -0.51 | -0.72 |
HERC1 | -0.51 | -0.69 |
RUSC2 | -0.51 | -0.69 |
NEURL4 | -0.50 | -0.72 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0003924 | GTPase activity | TAS | 9889007 | |
GO:0005525 | GTP binding | IEA | - | |
GO:0005198 | structural molecule activity | TAS | 9889007 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000910 | cytokinesis | TAS | 9889007 | |
GO:0007049 | cell cycle | IEA | - | |
GO:0042981 | regulation of apoptosis | NAS | 11146656 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005634 | nucleus | NAS | 11146656 | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005739 | mitochondrion | NAS | 11146656 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
CEBALLOS TARGETS OF TP53 AND MYC DN | 38 | 31 | All SZGR 2.0 genes in this pathway |
SHEN SMARCA2 TARGETS DN | 357 | 212 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 17Q21 Q25 AMPLICON | 335 | 181 | All SZGR 2.0 genes in this pathway |
SANA RESPONSE TO IFNG UP | 78 | 50 | All SZGR 2.0 genes in this pathway |
MANALO HYPOXIA UP | 207 | 145 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS DN | 366 | 238 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN UP | 262 | 186 | All SZGR 2.0 genes in this pathway |
JIANG AGING HYPOTHALAMUS UP | 47 | 31 | All SZGR 2.0 genes in this pathway |
MONNIER POSTRADIATION TUMOR ESCAPE DN | 373 | 196 | All SZGR 2.0 genes in this pathway |
LEIN ASTROCYTE MARKERS | 42 | 35 | All SZGR 2.0 genes in this pathway |
LEIN OLIGODENDROCYTE MARKERS | 74 | 53 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
MATZUK SPERMATOZOA | 114 | 77 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER SURVIVAL UP | 185 | 112 | All SZGR 2.0 genes in this pathway |
SEKI INFLAMMATORY RESPONSE LPS DN | 23 | 16 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS 60HR UP | 293 | 203 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G6 UP | 65 | 43 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS CTNNB1 UP | 176 | 110 | All SZGR 2.0 genes in this pathway |
DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 11 | 103 | 68 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 UP | 134 | 85 | All SZGR 2.0 genes in this pathway |
CHYLA CBFA2T3 TARGETS DN | 242 | 146 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN | 321 | 200 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
SERVITJA ISLET HNF1A TARGETS UP | 163 | 111 | All SZGR 2.0 genes in this pathway |
YANG BCL3 TARGETS UP | 364 | 236 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-214 | 115 | 122 | 1A,m8 | hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.