Gene Page: GTPBP2
Summary ?
GeneID | 54676 |
Symbol | GTPBP2 |
Synonyms | - |
Description | GTP binding protein 2 |
Reference | MIM:607434|HGNC:HGNC:4670|Ensembl:ENSG00000172432|HPRD:08465|Vega:OTTHUMG00000014744 |
Gene type | protein-coding |
Map location | 6p21 |
Pascal p-value | 1.82E-4 |
Sherlock p-value | 0.287 |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs11694212 | chr2 | 49449651 | GTPBP2 | 54676 | 0.08 | trans | ||
rs1427446 | chr2 | 49480305 | GTPBP2 | 54676 | 0.03 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0003924 | GTPase activity | IEA | - | |
GO:0003924 | GTPase activity | TAS | 10833435 | |
GO:0005525 | GTP binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007264 | small GTPase mediated signal transduction | TAS | 10833435 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN | 180 | 101 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
OZEN MIR125B1 TARGETS | 25 | 15 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
WANG TARGETS OF MLL CBP FUSION UP | 44 | 26 | All SZGR 2.0 genes in this pathway |
KUMAR TARGETS OF MLL AF9 FUSION | 405 | 264 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS MATURE CELL | 293 | 160 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
BILD HRAS ONCOGENIC SIGNATURE | 261 | 166 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS DN | 314 | 188 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
PODAR RESPONSE TO ADAPHOSTIN UP | 147 | 98 | All SZGR 2.0 genes in this pathway |
TAYLOR METHYLATED IN ACUTE LYMPHOBLASTIC LEUKEMIA | 77 | 52 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB UP | 245 | 159 | All SZGR 2.0 genes in this pathway |
MOOTHA PGC | 420 | 269 | All SZGR 2.0 genes in this pathway |
HIRSCH CELLULAR TRANSFORMATION SIGNATURE UP | 242 | 159 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
FOSTER KDM1A TARGETS DN | 211 | 119 | All SZGR 2.0 genes in this pathway |
VANOEVELEN MYOGENESIS SIN3A TARGETS | 220 | 133 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-103/107 | 61 | 67 | m8 | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
miR-125/351 | 1013 | 1020 | 1A,m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
miR-224 | 48 | 54 | m8 | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
miR-29 | 662 | 668 | 1A | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-378 | 360 | 366 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
miR-495 | 986 | 992 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.