SZGR2

Summary ?

GeneID	54715
Symbol	RBFOX1
Synonyms	2BP1\|A2BP1\|FOX-1\|FOX1\|HRNBP1
Description	RNA binding protein, fox-1 homolog (C. elegans) 1
Reference	MIM:605104\|HGNC:HGNC:18222\|Ensembl:ENSG00000078328\|HPRD:16091\|Vega:OTTHUMG00000129551
Gene type	protein-coding
Map location	16p13.3
Sherlock p-value	0.415
Fetal beta	0.891
DMG	1 (# studies)
eGene	Myers' cis & trans Meta
Support	Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWAScat	Genome-wide Association Studies	This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg00470955	16	7354432	RBFOX1	1.02E-7	-0.008	2.25E-5	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs6497287	chr15	28440286	RBFOX1	54715		0.12		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0003723	RNA binding	NAS		10814712
GO:0008022	protein C-terminus binding	IPI		10814712
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006397	mRNA processing	IEA		-
GO:0008380	RNA splicing	IEA		-
GO:0050658	RNA transport	NAS		10814712
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005802	trans-Golgi network	IDA		10814712
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IDA		10814712

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN	463	290	All SZGR 2.0 genes in this pathway
TAKADA GASTRIC CANCER COPY NUMBER DN	29	15	All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS UP	268	157	All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS DN	142	94	All SZGR 2.0 genes in this pathway
CAMPS COLON CANCER COPY NUMBER DN	74	34	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K27ME3 DN	228	114	All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN	940	425	All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE DN	264	159	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2	491	319	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3 UNMETHYLATED	228	119	All SZGR 2.0 genes in this pathway
IKEDA MIR1 TARGETS DN	7	7	All SZGR 2.0 genes in this pathway
IKEDA MIR30 TARGETS DN	27	24	All SZGR 2.0 genes in this pathway
SERVITJA ISLET HNF1A TARGETS UP	163	111	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR UP	199	143	All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN	308	187	All SZGR 2.0 genes in this pathway
ZWANG EGF PERSISTENTLY UP	32	24	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	154	160	1A	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-1/206	661	667	1A	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-129-5p	870	876	1A	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	870	876	1A	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-132/212	1003	1009	1A	hsa-miR-212^SZ	UAACAGUCUCCAGUCACGGCC
miR-132/212	1003	1009	1A	hsa-miR-132^brain	UAACAGUCUACAGCCAUGGUCG
miR-186	897	903	m8	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-186	897	903	m8	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-217	72	79	1A,m8	hsa-miR-217	UACUGCAUCAGGAACUGAUUGGAU
miR-27	1596	1602	1A	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	1596	1602	1A	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-299-5p	1723	1729	1A	hsa-miR-299-5p	UGGUUUACCGUCCCACAUACAU
miR-30-5p	1422	1429	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-320	1674	1680	m8	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-328	290	296	m8	hsa-miR-328^brain	CUGGCCCUCUCUGCCCUUCCGU
miR-328	290	296	m8	hsa-miR-328^brain	CUGGCCCUCUCUGCCCUUCCGU
miR-496	315	321	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-7	1460	1466	m8	hsa-miR-7^SZ	UGGAAGACUAGUGAUUUUGUUG
miR-7	1460	1466	m8	hsa-miR-7^SZ	UGGAAGACUAGUGAUUUUGUUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: RBFOX1