Gene Page: PPIB
Summary ?
GeneID | 5479 |
Symbol | PPIB |
Synonyms | CYP-S1|CYPB|HEL-S-39|OI9|SCYLP |
Description | peptidylprolyl isomerase B |
Reference | MIM:123841|HGNC:HGNC:9255|Ensembl:ENSG00000166794|HPRD:00458|Vega:OTTHUMG00000133018 |
Gene type | protein-coding |
Map location | 15q21-q22 |
Pascal p-value | 0.002 |
Sherlock p-value | 0.936 |
Support | RNA AND PROTEIN SYNTHESIS G2Cdb.humanPSD G2Cdb.humanPSP |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0171 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
DLSTP | 0.94 | 0.92 |
EFTUD2 | 0.93 | 0.93 |
PJA1 | 0.93 | 0.94 |
PTPN9 | 0.93 | 0.93 |
EDC3 | 0.93 | 0.93 |
TRIM27 | 0.93 | 0.93 |
RQCD1 | 0.93 | 0.92 |
PRPF4 | 0.92 | 0.93 |
C12orf41 | 0.92 | 0.91 |
PA2G4 | 0.92 | 0.90 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MT-CO2 | -0.81 | -0.88 |
AF347015.31 | -0.79 | -0.86 |
AF347015.27 | -0.78 | -0.86 |
AF347015.8 | -0.78 | -0.87 |
AF347015.33 | -0.78 | -0.85 |
MT-CYB | -0.77 | -0.85 |
FXYD1 | -0.75 | -0.84 |
AF347015.21 | -0.75 | -0.88 |
AF347015.15 | -0.74 | -0.84 |
IFI27 | -0.73 | -0.80 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003755 | peptidyl-prolyl cis-trans isomerase activity | NAS | 2000394 | |
GO:0016853 | isomerase activity | IEA | - | |
GO:0042277 | peptide binding | IEA | - | |
GO:0051082 | unfolded protein binding | TAS | 2000394 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006457 | protein folding | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005788 | endoplasmic reticulum lumen | NAS | 1530944 | |
GO:0005783 | endoplasmic reticulum | TAS | 2000394 | |
GO:0042470 | melanosome | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID SYNDECAN 1 PATHWAY | 46 | 29 | All SZGR 2.0 genes in this pathway |
REACTOME EXTRACELLULAR MATRIX ORGANIZATION | 87 | 42 | All SZGR 2.0 genes in this pathway |
REACTOME COLLAGEN FORMATION | 58 | 31 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS DN | 431 | 263 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR DN | 214 | 133 | All SZGR 2.0 genes in this pathway |
HAHTOLA MYCOSIS FUNGOIDES SKIN UP | 177 | 113 | All SZGR 2.0 genes in this pathway |
CHOW RASSF1 TARGETS DN | 29 | 19 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS UP | 293 | 179 | All SZGR 2.0 genes in this pathway |
TOMLINS PROSTATE CANCER UP | 40 | 27 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP | 479 | 299 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
SAKAI TUMOR INFILTRATING MONOCYTES DN | 81 | 51 | All SZGR 2.0 genes in this pathway |
SUNG METASTASIS STROMA UP | 110 | 70 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS B LYMPHOCYTE UP | 78 | 51 | All SZGR 2.0 genes in this pathway |
IIZUKA LIVER CANCER PROGRESSION G1 G2 DN | 25 | 18 | All SZGR 2.0 genes in this pathway |
PENG LEUCINE DEPRIVATION DN | 187 | 122 | All SZGR 2.0 genes in this pathway |
SASAKI ADULT T CELL LEUKEMIA | 176 | 122 | All SZGR 2.0 genes in this pathway |
PENG RAPAMYCIN RESPONSE DN | 245 | 154 | All SZGR 2.0 genes in this pathway |
PENG GLUTAMINE DEPRIVATION DN | 337 | 230 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
LEI MYB TARGETS | 318 | 215 | All SZGR 2.0 genes in this pathway |
LENAOUR DENDRITIC CELL MATURATION DN | 128 | 90 | All SZGR 2.0 genes in this pathway |
TAKAO RESPONSE TO UVB RADIATION UP | 86 | 55 | All SZGR 2.0 genes in this pathway |
KAAB HEART ATRIUM VS VENTRICLE UP | 249 | 170 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C7 | 68 | 44 | All SZGR 2.0 genes in this pathway |
ZHONG SECRETOME OF LUNG CANCER AND MACROPHAGE | 77 | 50 | All SZGR 2.0 genes in this pathway |
ZHONG SECRETOME OF LUNG CANCER AND ENDOTHELIUM | 66 | 47 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
GRADE METASTASIS DN | 45 | 31 | All SZGR 2.0 genes in this pathway |
GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
CUI GLUCOSE DEPRIVATION | 60 | 44 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS DN | 366 | 257 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 13 | 172 | 107 | All SZGR 2.0 genes in this pathway |
LI INDUCED T TO NATURAL KILLER UP | 307 | 182 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
LI DCP2 BOUND MRNA | 89 | 57 | All SZGR 2.0 genes in this pathway |
BILANGES RAPAMYCIN SENSITIVE VIA TSC1 AND TSC2 | 73 | 37 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 117 | 124 | 1A,m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.