Gene Page: ELP3
Summary ?
| GeneID | 55140 |
| Symbol | ELP3 |
| Synonyms | KAT9 |
| Description | elongator acetyltransferase complex subunit 3 |
| Reference | MIM:612722|HGNC:HGNC:20696|Ensembl:ENSG00000134014|HPRD:10936|Vega:OTTHUMG00000102124 |
| Gene type | protein-coding |
| Map location | 8p21.1 |
| Pascal p-value | 0.019 |
| Sherlock p-value | 0.852 |
| Fetal beta | -0.092 |
| eGene | Caudate basal ganglia Cerebellar Hemisphere Cerebellum Cortex Frontal Cortex BA9 Hippocampus Hypothalamus Nucleus accumbens basal ganglia Putamen basal ganglia Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03086 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.00057 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs13251987 | 8 | 27935535 | ELP3 | ENSG00000134014.12 | 1.011E-6 | 0.01 | -11655 | gtex_brain_putamen_basal |
| rs397715561 | 8 | 27938863 | ELP3 | ENSG00000134014.12 | 2.805E-6 | 0.01 | -8327 | gtex_brain_putamen_basal |
| rs35221601 | 8 | 27946015 | ELP3 | ENSG00000134014.12 | 1.08E-6 | 0.01 | -1175 | gtex_brain_putamen_basal |
| rs1377338 | 8 | 27946373 | ELP3 | ENSG00000134014.12 | 1.048E-6 | 0.01 | -817 | gtex_brain_putamen_basal |
| rs4732816 | 8 | 27947607 | ELP3 | ENSG00000134014.12 | 1.84E-6 | 0.01 | 417 | gtex_brain_putamen_basal |
| rs11779927 | 8 | 27947787 | ELP3 | ENSG00000134014.12 | 8.521E-7 | 0.01 | 597 | gtex_brain_putamen_basal |
| rs201756860 | 8 | 27947992 | ELP3 | ENSG00000134014.12 | 3.962E-6 | 0.01 | 802 | gtex_brain_putamen_basal |
| rs34247390 | 8 | 27948535 | ELP3 | ENSG00000134014.12 | 5.704E-7 | 0.01 | 1345 | gtex_brain_putamen_basal |
| rs28507502 | 8 | 27950008 | ELP3 | ENSG00000134014.12 | 5.081E-7 | 0.01 | 2818 | gtex_brain_putamen_basal |
| rs2305452 | 8 | 27950535 | ELP3 | ENSG00000134014.12 | 7.093E-7 | 0.01 | 3345 | gtex_brain_putamen_basal |
| rs2305451 | 8 | 27950670 | ELP3 | ENSG00000134014.12 | 7.114E-7 | 0.01 | 3480 | gtex_brain_putamen_basal |
| rs11786004 | 8 | 27951025 | ELP3 | ENSG00000134014.12 | 1.913E-6 | 0.01 | 3835 | gtex_brain_putamen_basal |
| rs13261052 | 8 | 27953876 | ELP3 | ENSG00000134014.12 | 1.944E-6 | 0.01 | 6686 | gtex_brain_putamen_basal |
| rs1563055 | 8 | 27954465 | ELP3 | ENSG00000134014.12 | 1.907E-6 | 0.01 | 7275 | gtex_brain_putamen_basal |
| rs2290371 | 8 | 27957313 | ELP3 | ENSG00000134014.12 | 5.029E-7 | 0.01 | 10123 | gtex_brain_putamen_basal |
| rs4732820 | 8 | 27963212 | ELP3 | ENSG00000134014.12 | 7.623E-7 | 0.01 | 16022 | gtex_brain_putamen_basal |
| rs4732822 | 8 | 27969805 | ELP3 | ENSG00000134014.12 | 5.165E-7 | 0.01 | 22615 | gtex_brain_putamen_basal |
| rs34460067 | 8 | 27982152 | ELP3 | ENSG00000134014.12 | 5.165E-7 | 0.01 | 34962 | gtex_brain_putamen_basal |
| rs12548838 | 8 | 27982954 | ELP3 | ENSG00000134014.12 | 5.876E-7 | 0.01 | 35764 | gtex_brain_putamen_basal |
| rs13248070 | 8 | 27985498 | ELP3 | ENSG00000134014.12 | 7.325E-7 | 0.01 | 38308 | gtex_brain_putamen_basal |
| rs13250007 | 8 | 27995722 | ELP3 | ENSG00000134014.12 | 8.658E-7 | 0.01 | 48532 | gtex_brain_putamen_basal |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003677 | DNA binding | IDA | 11714725 | |
| GO:0005506 | iron ion binding | IEA | - | |
| GO:0005515 | protein binding | IPI | 11714725 | |
| GO:0004402 | histone acetyltransferase activity | IEA | - | |
| GO:0016740 | transferase activity | IEA | - | |
| GO:0008607 | phosphorylase kinase regulator activity | IDA | 11818576 | |
| GO:0008415 | acyltransferase activity | IEA | - | |
| GO:0008080 | N-acetyltransferase activity | IEA | - | |
| GO:0016944 | RNA polymerase II transcription elongation factor activity | IDA | 11714725 | |
| GO:0046872 | metal ion binding | IEA | - | |
| GO:0051536 | iron-sulfur cluster binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006357 | regulation of transcription from RNA polymerase II promoter | IDA | 11818576 | |
| GO:0006350 | transcription | IEA | - | |
| GO:0008152 | metabolic process | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005730 | nucleolus | IDA | 11714725 | |
| GO:0005737 | cytoplasm | IDA | 11818576 | |
| GO:0008023 | transcription elongation factor complex | IDA | 11818576 | |
| GO:0016591 | DNA-directed RNA polymerase II, holoenzyme | IDA | 11714725 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| BENPORATH CYCLING GENES | 648 | 385 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER DN | 540 | 340 | All SZGR 2.0 genes in this pathway |
| KYNG WERNER SYNDROM AND NORMAL AGING UP | 93 | 62 | All SZGR 2.0 genes in this pathway |
| WHITFIELD CELL CYCLE M G1 | 148 | 95 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-410 | 389 | 395 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.