Gene Page: PRKCB
Summary ?
| GeneID | 5579 |
| Symbol | PRKCB |
| Synonyms | PKC-beta|PKCB|PRKCB1|PRKCB2 |
| Description | protein kinase C beta |
| Reference | MIM:176970|HGNC:HGNC:9395|Ensembl:ENSG00000166501|HPRD:01499|Vega:OTTHUMG00000131615 |
| Gene type | protein-coding |
| Map location | 16p11.2 |
| Pascal p-value | 0.009 |
| Sherlock p-value | 0.521 |
| Fetal beta | -3.108 |
| DMG | 1 (# studies) |
| eGene | Cerebellar Hemisphere Cerebellum |
| Support | CANABINOID INTRACELLULAR SIGNAL TRANSDUCTION METABOTROPIC GLUTAMATE RECEPTOR SEROTONIN G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.humanNRC CompositeSet Darnell FMRP targets Potential synaptic genes |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| DNM:Xu_2012 | Whole Exome Sequencing analysis | De novo mutations of 4 genes were identified by exome sequencing of 795 samples in this study | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 9.3648 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| PRKCB | chr16 | 24196438 | G | T | NM_002738 NM_212535 | p.514A>S p.514A>S | missense missense | Schizophrenia | DNM:Xu_2012 |
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg04279973 | 16 | 23846968 | PRKCB | 1.14E-9 | -0.014 | 1.25E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| ACAP2 | 0.88 | 0.86 |
| CLCN3 | 0.88 | 0.89 |
| CPD | 0.87 | 0.87 |
| SNX13 | 0.87 | 0.86 |
| KIAA0776 | 0.86 | 0.83 |
| ITCH | 0.86 | 0.83 |
| TM9SF3 | 0.86 | 0.87 |
| GFM1 | 0.86 | 0.87 |
| FAR1 | 0.86 | 0.83 |
| EEA1 | 0.86 | 0.86 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| C1orf61 | -0.48 | -0.55 |
| AF347015.21 | -0.48 | -0.38 |
| AL022328.1 | -0.47 | -0.50 |
| NUDT8 | -0.45 | -0.51 |
| ENHO | -0.45 | -0.49 |
| IL32 | -0.45 | -0.40 |
| C1orf54 | -0.44 | -0.41 |
| CSAG1 | -0.43 | -0.40 |
| MT-CO2 | -0.42 | -0.41 |
| HIGD1B | -0.41 | -0.40 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0004697 | protein kinase C activity | TAS | 3755548 | |
| GO:0005509 | calcium ion binding | IEA | - | |
| GO:0005515 | protein binding | IPI | 9765207 | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0016740 | transferase activity | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0019992 | diacylglycerol binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006468 | protein amino acid phosphorylation | TAS | 3755548 | |
| GO:0007242 | intracellular signaling cascade | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005829 | cytosol | EXP | 9814702 | |
| GO:0005737 | cytoplasm | TAS | 10828076 | |
| GO:0005886 | plasma membrane | EXP | 9814702 |10194441 |10856305 | |
| GO:0005886 | plasma membrane | TAS | 10828076 |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ADRBK1 | BARK1 | BETA-ARK1 | FLJ16718 | GRK2 | adrenergic, beta, receptor kinase 1 | - | HPRD | 12456365 |
| ADRBK1 | BARK1 | BETA-ARK1 | FLJ16718 | GRK2 | adrenergic, beta, receptor kinase 1 | Affinity Capture-Western Reconstituted Complex | BioGRID | 12679936 |
| AFAP1 | AFAP | AFAP-110 | FLJ56849 | actin filament associated protein 1 | - | HPRD,BioGRID | 12134071 |
| BTK | AGMX1 | AT | ATK | BPK | IMD1 | MGC126261 | MGC126262 | PSCTK1 | XLA | Bruton agammaglobulinemia tyrosine kinase | Reconstituted Complex | BioGRID | 12679936 |
| CDC2 | CDC28A | CDK1 | DKFZp686L20222 | MGC111195 | cell division cycle 2, G1 to S and G2 to M | Affinity Capture-Western | BioGRID | 11901153 |
| CSF2RB | CD131 | CDw131 | IL3RB | IL5RB | colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) | Affinity Capture-Western | BioGRID | 10490850 |
| EIF6 | 2 | CAB | EIF3A | ITGB4BP | b | b(2)gcn | gcn | p27BBP | eukaryotic translation initiation factor 6 | - | HPRD | 14654845 |
| GCNT1 | C2GNT | C2GNT-L | C2GNT1 | G6NT | MGC126335 | MGC126336 | NACGT2 | NAGCT2 | glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) | - | HPRD | 12765965 |
| GNA12 | MGC104623 | MGC99644 | NNX3 | RMP | gep | guanine nucleotide binding protein (G protein) alpha 12 | Biochemical Activity | BioGRID | 8824244 |
| GNA13 | G13 | MGC46138 | guanine nucleotide binding protein (G protein), alpha 13 | - | HPRD,BioGRID | 8824244 |
| GNB2L1 | Gnb2-rs1 | H12.3 | HLC-7 | PIG21 | RACK1 | guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 | Affinity Capture-Western Reconstituted Complex | BioGRID | 10480917 |
| GRIN1 | NMDA1 | NMDAR1 | NR1 | glutamate receptor, ionotropic, N-methyl D-aspartate 1 | - | HPRD | 10862698 |
| GSK3B | - | glycogen synthase kinase 3 beta | - | HPRD | 1324914 |
| HABP4 | IHABP4 | Ki-1/57 | MGC825 | SERBP1L | hyaluronan binding protein 4 | - | HPRD | 14699138 |
| LMNB1 | ADLD | LMN | LMN2 | LMNB | MGC111419 | lamin B1 | - | HPRD,BioGRID | 11901153 |
| MAPK6 | DKFZp686F03189 | ERK3 | HsT17250 | PRKM6 | p97MAPK | mitogen-activated protein kinase 6 | - | HPRD | 8626698 |
| MKI67 | KIA | Ki-67 | antigen identified by monoclonal antibody Ki-67 | - | HPRD | 10502411 |
| NCAM1 | CD56 | MSK39 | NCAM | neural cell adhesion molecule 1 | Affinity Capture-Western | BioGRID | 12743109 |
| NCF1 | FLJ79451 | NCF1A | NOXO2 | SH3PXD1A | p47phox | neutrophil cytosolic factor 1 | Affinity Capture-Western | BioGRID | 11120743 |
| PDLIM5 | ENH | ENH1 | L9 | LIM | PDZ and LIM domain 5 | - | HPRD,BioGRID | 8940095 |
| PDLIM7 | LMP1 | PDZ and LIM domain 7 (enigma) | - | HPRD | 8940095 |
| PDPK1 | MGC20087 | MGC35290 | PDK1 | PRO0461 | 3-phosphoinositide dependent protein kinase-1 | - | HPRD,BioGRID | 11376011 |
| RASGRP3 | GRP3 | KIAA0846 | RAS guanyl releasing protein 3 (calcium and DAG-regulated) | Biochemical Activity | BioGRID | 15213298 |
| RGS2 | G0S8 | regulator of G-protein signaling 2, 24kDa | - | HPRD,BioGRID | 11063746 |
| RIPK4 | ANKK2 | ANKRD3 | DIK | MGC129992 | MGC129993 | PKK | RIP4 | receptor-interacting serine-threonine kinase 4 | - | HPRD,BioGRID | 11278382 |
| SPTAN1 | (ALPHA)II-SPECTRIN | FLJ44613 | NEAS | spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) | - | HPRD | 8163551 |
| STAT3 | APRF | FLJ20882 | HIES | MGC16063 | signal transducer and activator of transcription 3 (acute-phase response factor) | An unspecified isoform of PKC-beta interacts with Stat3. | BIND | 10446219 |
| TIAM1 | FLJ36302 | T-cell lymphoma invasion and metastasis 1 | Biochemical Activity | BioGRID | 10212259 |
| YWHAG | 14-3-3GAMMA | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide | - | HPRD,BioGRID | 10433554 |
| ZMYND8 | MGC31836 | PRKCBP1 | PRO2893 | RACK7 | zinc finger, MYND-type containing 8 | - | HPRD | 11003709 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG MAPK SIGNALING PATHWAY | 267 | 205 | All SZGR 2.0 genes in this pathway |
| KEGG ERBB SIGNALING PATHWAY | 87 | 71 | All SZGR 2.0 genes in this pathway |
| KEGG CALCIUM SIGNALING PATHWAY | 178 | 134 | All SZGR 2.0 genes in this pathway |
| KEGG CHEMOKINE SIGNALING PATHWAY | 190 | 128 | All SZGR 2.0 genes in this pathway |
| KEGG PHOSPHATIDYLINOSITOL SIGNALING SYSTEM | 76 | 56 | All SZGR 2.0 genes in this pathway |
| KEGG VASCULAR SMOOTH MUSCLE CONTRACTION | 115 | 81 | All SZGR 2.0 genes in this pathway |
| KEGG WNT SIGNALING PATHWAY | 151 | 112 | All SZGR 2.0 genes in this pathway |
| KEGG VEGF SIGNALING PATHWAY | 76 | 53 | All SZGR 2.0 genes in this pathway |
| KEGG FOCAL ADHESION | 201 | 138 | All SZGR 2.0 genes in this pathway |
| KEGG TIGHT JUNCTION | 134 | 86 | All SZGR 2.0 genes in this pathway |
| KEGG GAP JUNCTION | 90 | 68 | All SZGR 2.0 genes in this pathway |
| KEGG NATURAL KILLER CELL MEDIATED CYTOTOXICITY | 137 | 92 | All SZGR 2.0 genes in this pathway |
| KEGG B CELL RECEPTOR SIGNALING PATHWAY | 75 | 56 | All SZGR 2.0 genes in this pathway |
| KEGG FC EPSILON RI SIGNALING PATHWAY | 79 | 58 | All SZGR 2.0 genes in this pathway |
| KEGG FC GAMMA R MEDIATED PHAGOCYTOSIS | 97 | 71 | All SZGR 2.0 genes in this pathway |
| KEGG LEUKOCYTE TRANSENDOTHELIAL MIGRATION | 118 | 78 | All SZGR 2.0 genes in this pathway |
| KEGG LONG TERM POTENTIATION | 70 | 57 | All SZGR 2.0 genes in this pathway |
| KEGG LONG TERM DEPRESSION | 70 | 53 | All SZGR 2.0 genes in this pathway |
| KEGG GNRH SIGNALING PATHWAY | 101 | 77 | All SZGR 2.0 genes in this pathway |
| KEGG MELANOGENESIS | 102 | 80 | All SZGR 2.0 genes in this pathway |
| KEGG ALDOSTERONE REGULATED SODIUM REABSORPTION | 42 | 29 | All SZGR 2.0 genes in this pathway |
| KEGG VIBRIO CHOLERAE INFECTION | 56 | 32 | All SZGR 2.0 genes in this pathway |
| KEGG LEISHMANIA INFECTION | 72 | 56 | All SZGR 2.0 genes in this pathway |
| KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
| KEGG GLIOMA | 65 | 56 | All SZGR 2.0 genes in this pathway |
| KEGG NON SMALL CELL LUNG CANCER | 54 | 47 | All SZGR 2.0 genes in this pathway |
| BIOCARTA SRCRPTP PATHWAY | 11 | 9 | All SZGR 2.0 genes in this pathway |
| BIOCARTA AT1R PATHWAY | 36 | 28 | All SZGR 2.0 genes in this pathway |
| BIOCARTA CHEMICAL PATHWAY | 22 | 15 | All SZGR 2.0 genes in this pathway |
| BIOCARTA SPPA PATHWAY | 22 | 18 | All SZGR 2.0 genes in this pathway |
| BIOCARTA AGPCR PATHWAY | 13 | 12 | All SZGR 2.0 genes in this pathway |
| BIOCARTA BCR PATHWAY | 37 | 28 | All SZGR 2.0 genes in this pathway |
| BIOCARTA BIOPEPTIDES PATHWAY | 45 | 35 | All SZGR 2.0 genes in this pathway |
| BIOCARTA CDMAC PATHWAY | 16 | 15 | All SZGR 2.0 genes in this pathway |
| BIOCARTA CBL PATHWAY | 13 | 10 | All SZGR 2.0 genes in this pathway |
| BIOCARTA CCR3 PATHWAY | 23 | 21 | All SZGR 2.0 genes in this pathway |
| BIOCARTA CXCR4 PATHWAY | 24 | 22 | All SZGR 2.0 genes in this pathway |
| BIOCARTA CALCINEURIN PATHWAY | 21 | 17 | All SZGR 2.0 genes in this pathway |
| BIOCARTA EGF PATHWAY | 31 | 25 | All SZGR 2.0 genes in this pathway |
| BIOCARTA FCER1 PATHWAY | 41 | 30 | All SZGR 2.0 genes in this pathway |
| BIOCARTA GH PATHWAY | 28 | 22 | All SZGR 2.0 genes in this pathway |
| BIOCARTA KERATINOCYTE PATHWAY | 46 | 38 | All SZGR 2.0 genes in this pathway |
| BIOCARTA PYK2 PATHWAY | 31 | 24 | All SZGR 2.0 genes in this pathway |
| BIOCARTA PPARA PATHWAY | 58 | 43 | All SZGR 2.0 genes in this pathway |
| BIOCARTA NOS1 PATHWAY | 24 | 21 | All SZGR 2.0 genes in this pathway |
| BIOCARTA ARENRF2 PATHWAY | 13 | 9 | All SZGR 2.0 genes in this pathway |
| BIOCARTA PDGF PATHWAY | 32 | 25 | All SZGR 2.0 genes in this pathway |
| BIOCARTA CCR5 PATHWAY | 20 | 16 | All SZGR 2.0 genes in this pathway |
| BIOCARTA EDG1 PATHWAY | 27 | 24 | All SZGR 2.0 genes in this pathway |
| BIOCARTA MYOSIN PATHWAY | 31 | 22 | All SZGR 2.0 genes in this pathway |
| BIOCARTA EIF4 PATHWAY | 24 | 19 | All SZGR 2.0 genes in this pathway |
| BIOCARTA CARDIACEGF PATHWAY | 18 | 16 | All SZGR 2.0 genes in this pathway |
| BIOCARTA MEF2D PATHWAY | 23 | 16 | All SZGR 2.0 genes in this pathway |
| BIOCARTA GPCR PATHWAY | 37 | 31 | All SZGR 2.0 genes in this pathway |
| BIOCARTA TCR PATHWAY | 49 | 37 | All SZGR 2.0 genes in this pathway |
| BIOCARTA PAR1 PATHWAY | 37 | 28 | All SZGR 2.0 genes in this pathway |
| BIOCARTA TPO PATHWAY | 24 | 17 | All SZGR 2.0 genes in this pathway |
| BIOCARTA CREB PATHWAY | 27 | 25 | All SZGR 2.0 genes in this pathway |
| BIOCARTA TRKA PATHWAY | 12 | 10 | All SZGR 2.0 genes in this pathway |
| BIOCARTA VEGF PATHWAY | 29 | 18 | All SZGR 2.0 genes in this pathway |
| PID FCER1 PATHWAY | 62 | 43 | All SZGR 2.0 genes in this pathway |
| PID ENDOTHELIN PATHWAY | 63 | 52 | All SZGR 2.0 genes in this pathway |
| PID TCR PATHWAY | 66 | 51 | All SZGR 2.0 genes in this pathway |
| PID CD8 TCR PATHWAY | 53 | 42 | All SZGR 2.0 genes in this pathway |
| PID TXA2PATHWAY | 57 | 43 | All SZGR 2.0 genes in this pathway |
| PID NFAT 3PATHWAY | 54 | 47 | All SZGR 2.0 genes in this pathway |
| PID IL2 1PATHWAY | 55 | 43 | All SZGR 2.0 genes in this pathway |
| PID TCR RAS PATHWAY | 14 | 14 | All SZGR 2.0 genes in this pathway |
| PID TCR JNK PATHWAY | 14 | 11 | All SZGR 2.0 genes in this pathway |
| PID IL8 CXCR2 PATHWAY | 34 | 26 | All SZGR 2.0 genes in this pathway |
| PID VEGFR1 PATHWAY | 26 | 23 | All SZGR 2.0 genes in this pathway |
| PID VEGFR1 2 PATHWAY | 69 | 57 | All SZGR 2.0 genes in this pathway |
| PID THROMBIN PAR1 PATHWAY | 43 | 32 | All SZGR 2.0 genes in this pathway |
| PID IL8 CXCR1 PATHWAY | 28 | 19 | All SZGR 2.0 genes in this pathway |
| PID RAS PATHWAY | 30 | 22 | All SZGR 2.0 genes in this pathway |
| PID CD8 TCR DOWNSTREAM PATHWAY | 65 | 56 | All SZGR 2.0 genes in this pathway |
| REACTOME DOWNSTREAM SIGNALING EVENTS OF B CELL RECEPTOR BCR | 97 | 66 | All SZGR 2.0 genes in this pathway |
| REACTOME ACTIVATION OF NF KAPPAB IN B CELLS | 64 | 43 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY THE B CELL RECEPTOR BCR | 126 | 90 | All SZGR 2.0 genes in this pathway |
| REACTOME RESPONSE TO ELEVATED PLATELET CYTOSOLIC CA2 | 89 | 56 | All SZGR 2.0 genes in this pathway |
| REACTOME TRANSMISSION ACROSS CHEMICAL SYNAPSES | 186 | 155 | All SZGR 2.0 genes in this pathway |
| REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
| REACTOME NEUROTRANSMITTER RECEPTOR BINDING AND DOWNSTREAM TRANSMISSION IN THE POSTSYNAPTIC CELL | 137 | 110 | All SZGR 2.0 genes in this pathway |
| REACTOME TRAFFICKING OF AMPA RECEPTORS | 28 | 23 | All SZGR 2.0 genes in this pathway |
| REACTOME TRAFFICKING OF GLUR2 CONTAINING AMPA RECEPTORS | 16 | 11 | All SZGR 2.0 genes in this pathway |
| REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
| REACTOME G ALPHA Z SIGNALLING EVENTS | 44 | 29 | All SZGR 2.0 genes in this pathway |
| REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
| REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
| REACTOME ADAPTIVE IMMUNE SYSTEM | 539 | 350 | All SZGR 2.0 genes in this pathway |
| REACTOME PLATELET ACTIVATION SIGNALING AND AGGREGATION | 208 | 138 | All SZGR 2.0 genes in this pathway |
| SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 DN | 175 | 82 | All SZGR 2.0 genes in this pathway |
| DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN | 320 | 184 | All SZGR 2.0 genes in this pathway |
| HOEBEKE LYMPHOID STEM CELL UP | 95 | 64 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| SABATES COLORECTAL ADENOMA DN | 291 | 176 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
| CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS UP | 126 | 72 | All SZGR 2.0 genes in this pathway |
| VANHARANTA UTERINE FIBROID UP | 45 | 26 | All SZGR 2.0 genes in this pathway |
| SHI SPARC TARGETS UP | 24 | 17 | All SZGR 2.0 genes in this pathway |
| WATTEL AUTONOMOUS THYROID ADENOMA UP | 73 | 47 | All SZGR 2.0 genes in this pathway |
| BALLIF DEVELOPMENTAL DISABILITY P16 P12 DELETION | 13 | 8 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR UP | 176 | 115 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT AND CANCER BOX4 UP | 11 | 8 | All SZGR 2.0 genes in this pathway |
| PASQUALUCCI LYMPHOMA BY GC STAGE DN | 165 | 104 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| SHIPP DLBCL CURED VS FATAL DN | 45 | 30 | All SZGR 2.0 genes in this pathway |
| BASSO B LYMPHOCYTE NETWORK | 143 | 96 | All SZGR 2.0 genes in this pathway |
| SHEPARD BMYB MORPHOLINO DN | 200 | 112 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK UP | 87 | 58 | All SZGR 2.0 genes in this pathway |
| TARTE PLASMA CELL VS PLASMABLAST DN | 309 | 206 | All SZGR 2.0 genes in this pathway |
| PENG RAPAMYCIN RESPONSE UP | 203 | 130 | All SZGR 2.0 genes in this pathway |
| ZHANG TARGETS OF EWSR1 FLI1 FUSION | 88 | 68 | All SZGR 2.0 genes in this pathway |
| HOFMANN CELL LYMPHOMA UP | 50 | 35 | All SZGR 2.0 genes in this pathway |
| YU MYC TARGETS DN | 55 | 38 | All SZGR 2.0 genes in this pathway |
| THEILGAARD NEUTROPHIL AT SKIN WOUND DN | 225 | 163 | All SZGR 2.0 genes in this pathway |
| ZHAN MULTIPLE MYELOMA CD1 VS CD2 DN | 52 | 35 | All SZGR 2.0 genes in this pathway |
| MCCLUNG DELTA FOSB TARGETS 8WK | 47 | 38 | All SZGR 2.0 genes in this pathway |
| MODY HIPPOCAMPUS POSTNATAL | 63 | 50 | All SZGR 2.0 genes in this pathway |
| LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| RAMALHO STEMNESS DN | 74 | 55 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 18HR DN | 178 | 121 | All SZGR 2.0 genes in this pathway |
| JOSEPH RESPONSE TO SODIUM BUTYRATE UP | 31 | 21 | All SZGR 2.0 genes in this pathway |
| DURCHDEWALD SKIN CARCINOGENESIS UP | 88 | 47 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
| FINETTI BREAST CANCER KINOME GREEN | 16 | 14 | All SZGR 2.0 genes in this pathway |
| OUYANG PROSTATE CANCER PROGRESSION UP | 20 | 14 | All SZGR 2.0 genes in this pathway |
| RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER LUMINAL B DN | 564 | 326 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
| CHUNG BLISTER CYTOTOXICITY DN | 44 | 29 | All SZGR 2.0 genes in this pathway |
| LABBE WNT3A TARGETS DN | 97 | 53 | All SZGR 2.0 genes in this pathway |
| NAKAMURA METASTASIS | 47 | 28 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO CSF2RB AND IL4 DN | 315 | 201 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO HGF DN | 235 | 144 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP | 408 | 276 | All SZGR 2.0 genes in this pathway |
| HOFMANN MYELODYSPLASTIC SYNDROM LOW RISK UP | 22 | 15 | All SZGR 2.0 genes in this pathway |
| LEE DIFFERENTIATING T LYMPHOCYTE | 200 | 115 | All SZGR 2.0 genes in this pathway |
| POOLA INVASIVE BREAST CANCER UP | 288 | 168 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH 11Q23 REARRANGED | 351 | 238 | All SZGR 2.0 genes in this pathway |
| WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 4HR DN | 254 | 158 | All SZGR 2.0 genes in this pathway |
| RAGHAVACHARI PLATELET SPECIFIC GENES | 70 | 46 | All SZGR 2.0 genes in this pathway |
| LI INDUCED T TO NATURAL KILLER DN | 116 | 83 | All SZGR 2.0 genes in this pathway |
| WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP | 397 | 206 | All SZGR 2.0 genes in this pathway |
| WIERENGA PML INTERACTOME | 42 | 23 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-129-5p | 822 | 829 | 1A,m8 | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
| hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
| miR-184 | 16 | 22 | m8 | hsa-miR-184 | UGGACGGAGAACUGAUAAGGGU |
| miR-194 | 864 | 870 | 1A | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
| miR-203.1 | 771 | 778 | 1A,m8 | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
| miR-330 | 918 | 925 | 1A,m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
| hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA | ||||
| miR-450 | 822 | 828 | 1A | hsa-miR-450 | UUUUUGCGAUGUGUUCCUAAUA |
| miR-494 | 128 | 134 | 1A | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.