Gene Page: PTBP1
Summary ?
GeneID | 5725 |
Symbol | PTBP1 |
Synonyms | HNRNP-I|HNRNPI|HNRPI|PTB|PTB-1|PTB-T|PTB2|PTB3|PTB4|pPTB |
Description | polypyrimidine tract binding protein 1 |
Reference | MIM:600693|HGNC:HGNC:9583|Ensembl:ENSG00000011304|HPRD:02823|Vega:OTTHUMG00000181789 |
Gene type | protein-coding |
Map location | 19p13.3 |
Pascal p-value | 0.276 |
Sherlock p-value | 0.002 |
Fetal beta | 0.945 |
DMG | 2 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:vanEijk_2014 | Genome-wide DNA methylation analysis | This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). | 6 |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 6 |
Expression | Meta-analysis of gene expression | P value: 1.41 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg17357561 | 19 | 807322 | PTBP1 | 3.767E-4 | 0.458 | 0.043 | DMG:Wockner_2014 |
cg07073964 | 19 | 698371 | PTBP1 | 5.303E-4 | 2.907 | DMG:vanEijk_2014 | |
cg17823175 | 19 | 828170 | PTBP1 | 1.157E-4 | 2.471 | DMG:vanEijk_2014 | |
cg07239938 | 19 | 852813 | PTBP1 | 4.209E-4 | 2.06 | DMG:vanEijk_2014 | |
cg09134726 | 19 | 841082 | PTBP1 | 4.309E-4 | 2.012 | DMG:vanEijk_2014 | |
cg18084554 | 19 | 929046 | PTBP1 | 1.745E-4 | 1.976 | DMG:vanEijk_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs4436485 | chr10 | 103245360 | PTBP1 | 5725 | 0.19 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
HNRNPH3 | 0.93 | 0.92 |
HNRNPA1P2 | 0.92 | 0.84 |
HDAC2 | 0.92 | 0.84 |
ANP32A | 0.90 | 0.87 |
SUMO2 | 0.90 | 0.84 |
SMARCE1 | 0.90 | 0.88 |
HNRNPH1 | 0.89 | 0.86 |
CBX3 | 0.89 | 0.81 |
HAUS1 | 0.89 | 0.76 |
SET | 0.89 | 0.84 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
TNFSF12 | -0.62 | -0.68 |
PTH1R | -0.61 | -0.75 |
HLA-F | -0.61 | -0.73 |
ALDOC | -0.60 | -0.71 |
C5orf53 | -0.60 | -0.70 |
LDHD | -0.59 | -0.70 |
AIFM3 | -0.59 | -0.71 |
FBXO2 | -0.59 | -0.66 |
TSC22D4 | -0.59 | -0.73 |
CA4 | -0.58 | -0.76 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0003676 | nucleic acid binding | IEA | - | |
GO:0003723 | RNA binding | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0005515 | protein binding | IPI | 10653975 |16373488 |16713569 | |
GO:0008187 | poly-pyrimidine tract binding | TAS | 1906036 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000398 | nuclear mRNA splicing, via spliceosome | EXP | 12226669 | |
GO:0006397 | mRNA processing | IEA | - | |
GO:0008380 | RNA splicing | TAS | 1906036 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005654 | nucleoplasm | TAS | 1641332 | |
GO:0005730 | nucleolus | TAS | 1641332 | |
GO:0030530 | heterogeneous nuclear ribonucleoprotein complex | TAS | 1641332 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME PROCESSING OF CAPPED INTRON CONTAINING PRE MRNA | 140 | 77 | All SZGR 2.0 genes in this pathway |
REACTOME MRNA PROCESSING | 161 | 86 | All SZGR 2.0 genes in this pathway |
REACTOME MRNA SPLICING | 111 | 58 | All SZGR 2.0 genes in this pathway |
PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
LIU SOX4 TARGETS DN | 309 | 191 | All SZGR 2.0 genes in this pathway |
PRAMOONJAGO SOX4 TARGETS DN | 51 | 35 | All SZGR 2.0 genes in this pathway |
PUIFFE INVASION INHIBITED BY ASCITES UP | 82 | 51 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN | 335 | 193 | All SZGR 2.0 genes in this pathway |
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN | 180 | 101 | All SZGR 2.0 genes in this pathway |
ODONNELL TFRC TARGETS UP | 456 | 228 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS UP | 457 | 269 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS UP | 238 | 144 | All SZGR 2.0 genes in this pathway |
SENESE HDAC2 TARGETS UP | 114 | 66 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
WOOD EBV EBNA1 TARGETS UP | 110 | 71 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
PENG LEUCINE DEPRIVATION DN | 187 | 122 | All SZGR 2.0 genes in this pathway |
NING CHRONIC OBSTRUCTIVE PULMONARY DISEASE UP | 157 | 105 | All SZGR 2.0 genes in this pathway |
PENG RAPAMYCIN RESPONSE DN | 245 | 154 | All SZGR 2.0 genes in this pathway |
SCHLINGEMANN SKIN CARCINOGENESIS TPA UP | 42 | 24 | All SZGR 2.0 genes in this pathway |
JIANG VHL TARGETS | 138 | 91 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D DN | 270 | 181 | All SZGR 2.0 genes in this pathway |
GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
MELLMAN TUT1 TARGETS UP | 19 | 11 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA VIA VHL | 34 | 24 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
LOPEZ TRANSLATION VIA FN1 SIGNALING | 35 | 21 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 45 | 51 | 1A | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-124.1 | 330 | 337 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 329 | 336 | 1A,m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-133 | 1031 | 1037 | 1A | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
miR-153 | 687 | 693 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
miR-17-5p/20/93.mr/106/519.d | 61 | 67 | 1A | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-200bc/429 | 1292 | 1298 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-326 | 94 | 100 | 1A | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
miR-448 | 686 | 693 | 1A,m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
miR-9 | 1033 | 1039 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.