SZGR2

Summary ?

GeneID	5743
Symbol	PTGS2
Synonyms	COX-2\|COX2\|GRIPGHS\|PGG/HS\|PGHS-2\|PHS-2\|hCox-2
Description	prostaglandin-endoperoxide synthase 2
Reference	MIM:600262\|HGNC:HGNC:9605\|Ensembl:ENSG00000073756\|HPRD:02599\|Vega:OTTHUMG00000035473
Gene type	protein-coding
Map location	1q25.2-q25.3
Sherlock p-value	0.985
Fetal beta	-2.04
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWAScat	Genome-wide Association Studies	This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	1	Link to SZGene
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs6677917	chr1	34406841	PTGS2	5743	0.19	trans
rs983619	chr1	39047418	PTGS2	5743	0.03	trans
rs7545984	chr1	45003892	PTGS2	5743	0.01	trans
rs7554123	chr1	45004203	PTGS2	5743	0.01	trans
rs12059674	chr1	57630277	PTGS2	5743	0.01	trans
rs17126801	chr1	65098162	PTGS2	5743	0.01	trans
rs7511937		0	PTGS2	5743	0	trans
rs2782784	chr1	71195282	PTGS2	5743	0.02	trans
rs2257700	chr1	71273516	PTGS2	5743	0.06	trans
rs7541092	chr1	71362471	PTGS2	5743	0.08	trans
rs17689089	chr1	77740105	PTGS2	5743	0	trans
rs17100231	chr1	77761339	PTGS2	5743	0.01	trans
rs17100274	chr1	77774412	PTGS2	5743	1.457E-5	trans
rs12034005	chr1	79793034	PTGS2	5743	0.1	trans
rs3015033	chr1	79847235	PTGS2	5743	0.01	trans
rs17098656	chr1	80098386	PTGS2	5743	0.01	trans
rs6664544	chr1	92524192	PTGS2	5743	0	trans
rs12403481	chr1	109503655	PTGS2	5743	0	trans
rs337294		0	PTGS2	5743	0.02	trans
rs17029293	chr1	112567844	PTGS2	5743	4.593E-4	trans
rs16837984	chr1	157042626	PTGS2	5743	0	trans
rs16837989	chr1	157046286	PTGS2	5743	0.03	trans
rs16838012	chr1	157048974	PTGS2	5743	0	trans
rs16838014		0	PTGS2	5743	0	trans
rs6666937	chr1	170286842	PTGS2	5743	2.823E-4	trans
rs6701323	chr1	178588280	PTGS2	5743	0.08	trans
rs12071422	chr1	185573879	PTGS2	5743	0.01	trans
rs697455	chr1	202512075	PTGS2	5743	0.02	trans
rs4457633	chr1	204283819	PTGS2	5743	0.11	trans
rs3748669	chr1	207077022	PTGS2	5743	0.02	trans
rs6673109	chr1	207253132	PTGS2	5743	8.556E-4	trans
rs17260245	chr1	209411024	PTGS2	5743	0.15	trans
rs1796829	chr1	239661818	PTGS2	5743	6.842E-5	trans
rs1416379	chr1	239708983	PTGS2	5743	0.09	trans
rs12034521	chr1	239717679	PTGS2	5743	3.682E-6	trans
rs6670526	chr1	239725414	PTGS2	5743	0.04	trans
snp_a-1990354		0	PTGS2	5743	2.474E-7	trans
rs10802777	chr1	239750391	PTGS2	5743	0.13	trans
rs939217	chr2	12730751	PTGS2	5743	0.02	trans
rs6432434	chr2	14160930	PTGS2	5743	0	trans
rs6712107	chr2	14178653	PTGS2	5743	0.11	trans
rs16861129	chr2	14201738	PTGS2	5743	0.11	trans
rs16861131	chr2	14202085	PTGS2	5743	0.11	trans
rs12329305	chr2	19552912	PTGS2	5743	0	trans
rs12611832	chr2	31196248	PTGS2	5743	0.02	trans
rs12614732	chr2	31199913	PTGS2	5743	0.02	trans
rs7560081	chr2	62793238	PTGS2	5743	0	trans
rs17029079	chr2	64736071	PTGS2	5743	0.01	trans
rs17038084	chr2	85192280	PTGS2	5743	1.051E-4	trans
rs17024035	chr2	100968559	PTGS2	5743	0.01	trans
rs7574684	chr2	100992911	PTGS2	5743	0.01	trans
rs17024129	chr2	100995144	PTGS2	5743	0.01	trans
rs17024136	chr2	100995382	PTGS2	5743	0.06	trans
rs7585898	chr2	100998292	PTGS2	5743	0.01	trans
rs6716367	chr2	101000013	PTGS2	5743	0.11	trans
rs1370627	chr2	101009384	PTGS2	5743	0.01	trans
rs4149509	chr2	101023698	PTGS2	5743	0.14	trans
rs1840209	chr2	125625401	PTGS2	5743	0.01	trans
rs6707117	chr2	136855504	PTGS2	5743	3.283E-11	trans
rs17834293	chr2	142993878	PTGS2	5743	0.16	trans
rs7564795	chr2	143033291	PTGS2	5743	0.09	trans
rs10189091	chr2	143471999	PTGS2	5743	0	trans
snp_a-2198363		0	PTGS2	5743	0	trans
rs707097	chr2	155318814	PTGS2	5743	0.07	trans
rs7608942	chr2	182820100	PTGS2	5743	0.02	trans
rs16848675	chr2	213349996	PTGS2	5743	0.04	trans
rs16857299	chr2	218177932	PTGS2	5743	0.19	trans
rs16829292	chr2	233447622	PTGS2	5743	0.01	trans
rs16829401	chr2	233538391	PTGS2	5743	0	trans
rs17040622	chr3	4440673	PTGS2	5743	0.03	trans
rs17684934	chr3	4443547	PTGS2	5743	7.985E-4	trans
rs17040633	chr3	4446836	PTGS2	5743	7.985E-4	trans
rs17756483	chr3	4451309	PTGS2	5743	7.985E-4	trans
rs17685441	chr3	4465165	PTGS2	5743	7.985E-4	trans
rs17015415	chr3	24933888	PTGS2	5743	0.09	trans
rs12639503	chr3	51860816	PTGS2	5743	0.03	trans
rs9863778	chr3	55375950	PTGS2	5743	0.04	trans
rs997245	chr3	61844600	PTGS2	5743	0	trans
rs3796213	chr3	69157380	PTGS2	5743	0.02	trans
rs6549186	chr3	69211954	PTGS2	5743	0.05	trans
rs2875492	chr3	86006209	PTGS2	5743	0.01	trans
rs16843128	chr3	100713413	PTGS2	5743	0	trans
rs1381835	chr3	110600595	PTGS2	5743	0.02	trans
rs1877965	chr3	126013904	PTGS2	5743	0.2	trans
rs16839796	chr4	7188348	PTGS2	5743	2.564E-4	trans
rs4631023	chr4	8101794	PTGS2	5743	0.03	trans
rs7684087	chr4	21673380	PTGS2	5743	0.01	trans
rs16885724	chr4	31717283	PTGS2	5743	0.18	trans
rs16989064	chr4	33639397	PTGS2	5743	0.01	trans
rs4469113	chr4	41461062	PTGS2	5743	5.964E-4	trans
rs6836259	chr4	57173074	PTGS2	5743	0.08	trans
rs2643038	chr4	62313218	PTGS2	5743	0.03	trans
rs6817626	chr4	78005836	PTGS2	5743	0.06	trans
rs1604153	chr4	78472744	PTGS2	5743	0.01	trans
rs1564462	chr4	79910988	PTGS2	5743	0.04	trans
rs6827713	chr4	79936877	PTGS2	5743	0.03	trans
rs17005000	chr4	81826551	PTGS2	5743	0.13	trans
rs10011751	chr4	93984994	PTGS2	5743	0.02	trans
rs11099888	chr4	154498555	PTGS2	5743	0.1	trans
rs6881821	chr5	8578465	PTGS2	5743	2.192E-4	trans
rs9312843	chr5	13802997	PTGS2	5743	0	trans
rs1732944	chr5	30905595	PTGS2	5743	0.01	trans
rs1697073	chr5	30907267	PTGS2	5743	6.097E-4	trans
rs9292700	chr5	38192610	PTGS2	5743	0.14	trans
rs2115110	chr5	38193428	PTGS2	5743	3.993E-5	trans
rs16873956	chr5	44312488	PTGS2	5743	0	trans
rs10040715	chr5	57594207	PTGS2	5743	4.162E-11	trans
rs16894149	chr5	61013724	PTGS2	5743	0.19	trans
snp_a-4217300		0	PTGS2	5743	1.424E-6	trans
rs1862599	chr5	82095088	PTGS2	5743	0.01	trans
rs163953	chr5	92289536	PTGS2	5743	0.01	trans
rs17134275	chr5	100634998	PTGS2	5743	9.448E-4	trans
rs17257221	chr5	101016609	PTGS2	5743	0.07	trans
rs10063272	chr5	103540974	PTGS2	5743	0.19	trans
rs2963232	chr5	103713882	PTGS2	5743	0.02	trans
rs265412	chr5	114530112	PTGS2	5743	0.13	trans
rs250323	chr5	115646995	PTGS2	5743	0.04	trans
rs1350578	chr5	116310282	PTGS2	5743	0.03	trans
rs2900115	chr5	117414349	PTGS2	5743	0.04	trans
rs11955842	chr5	118066618	PTGS2	5743	0.03	trans
rs2141482	chr5	136760477	PTGS2	5743	6.834E-5	trans
rs2189803	chr5	137684661	PTGS2	5743	3.554E-8	trans
rs17098723	chr5	141860096	PTGS2	5743	0.13	trans
rs17063216	chr5	163777647	PTGS2	5743	0.08	trans
rs17063224	chr5	163780687	PTGS2	5743	0.08	trans
snp_a-2055204		0	PTGS2	5743	0.06	trans
rs259913	chr5	169370782	PTGS2	5743	7.283E-5	trans
rs2116811	chr5	171820051	PTGS2	5743	2.531E-4	trans
rs258875	chr5	173046554	PTGS2	5743	0.03	trans
rs16883859	chr6	20474617	PTGS2	5743	0.17	trans
rs16883862	chr6	20474766	PTGS2	5743	0.17	trans
rs10484635	chr6	20538664	PTGS2	5743	0.08	trans
rs7747254	chr6	24013530	PTGS2	5743	0.09	trans
rs3909134	chr6	29699252	PTGS2	5743	0.15	trans
rs195429	chr6	37354434	PTGS2	5743	0.02	trans
rs16890522	chr6	38236301	PTGS2	5743	0.18	trans
rs12528414	chr6	38404800	PTGS2	5743	0.05	trans
rs7764900	chr6	38440495	PTGS2	5743	0.14	trans
rs17069171	chr6	108335593	PTGS2	5743	0.11	trans
rs391196	chr6	111563907	PTGS2	5743	0.12	trans
rs4289676	chr6	123999302	PTGS2	5743	0	trans
rs17055235	chr6	128355263	PTGS2	5743	0.09	trans
rs2030024	chr6	131014624	PTGS2	5743	0	trans
rs10485094	chr6	131071433	PTGS2	5743	4.92E-4	trans
rs17059517	chr6	131076254	PTGS2	5743	0	trans
rs9402280	chr6	131102770	PTGS2	5743	0.02	trans
rs17062925	chr6	134168614	PTGS2	5743	0.17	trans
rs7767456	chr6	134356119	PTGS2	5743	0.03	trans
rs12176346	chr6	136732663	PTGS2	5743	0	trans
rs9402819	chr6	136848169	PTGS2	5743	0	trans
rs9389400	chr6	136854803	PTGS2	5743	0	trans
rs2237264	chr6	136919977	PTGS2	5743	0	trans
rs12164028	chr6	136929934	PTGS2	5743	0.15	trans
rs17080121	chr6	151009189	PTGS2	5743	0.01	trans
rs12529269	chr6	153543829	PTGS2	5743	0	trans
rs10872699	chr6	153544252	PTGS2	5743	3.473E-5	trans
rs1321606	chr6	153545278	PTGS2	5743	0	trans
rs10945911	chr6	164047509	PTGS2	5743	5.507E-5	trans
rs12540348	chr7	25802146	PTGS2	5743	0.01	trans
rs4719825	chr7	25813917	PTGS2	5743	0.04	trans
rs6461881	chr7	25837688	PTGS2	5743	0.03	trans
rs13239699	chr7	26377619	PTGS2	5743	0.01	trans
rs6462054	chr7	27886170	PTGS2	5743	0	trans
rs17156078	chr7	27988688	PTGS2	5743	0	trans
rs12701006	chr7	30147298	PTGS2	5743	1.156E-5	trans
rs1156490	chr7	34334956	PTGS2	5743	0.09	trans
rs1419793	chr7	34697630	PTGS2	5743	0.09	trans
rs17815964	chr7	52540908	PTGS2	5743	0.1	trans
rs17621151	chr7	53572911	PTGS2	5743	4.651E-4	trans
rs10245449	chr7	80935100	PTGS2	5743	0.01	trans
rs2272618	chr7	107871360	PTGS2	5743	0.13	trans
rs12669568	chr7	107885942	PTGS2	5743	0.13	trans
rs7777322	chr7	107886663	PTGS2	5743	0.13	trans
rs12671672	chr7	117614219	PTGS2	5743	0.08	trans
rs10487383	chr7	117671737	PTGS2	5743	0	trans
rs6958821	chr7	153253566	PTGS2	5743	0.01	trans
rs1865462	chr7	157637961	PTGS2	5743	0.16	trans
rs11779237	chr8	1227664	PTGS2	5743	0.03	trans
rs1358128	chr8	5268072	PTGS2	5743	0.01	trans
rs12682256	chr8	5306138	PTGS2	5743	0.01	trans
rs1010895	chr8	14580230	PTGS2	5743	0.04	trans
rs10109456	chr8	19565941	PTGS2	5743	0.02	trans
rs16877878	chr8	31176024	PTGS2	5743	0.17	trans
rs16877914	chr8	31196384	PTGS2	5743	0.03	trans
rs1457044	chr8	59257567	PTGS2	5743	3.301E-7	trans
rs1457032	chr8	59290536	PTGS2	5743	2.758E-5	trans
rs2680903	chr8	59512333	PTGS2	5743	0.03	trans
rs2634533	chr8	59535621	PTGS2	5743	0.03	trans
rs7465259		0	PTGS2	5743	0.05	trans
rs10104622	chr8	63333773	PTGS2	5743	0.05	trans
rs2218911	chr8	63371015	PTGS2	5743	0.05	trans
rs1551199	chr8	63388117	PTGS2	5743	0.05	trans
rs1733950	chr8	90062516	PTGS2	5743	2.25E-10	trans
rs1240028	chr8	90093357	PTGS2	5743	1.925E-4	trans
rs1240087	chr8	90113945	PTGS2	5743	9.595E-4	trans
rs318307	chr8	90185459	PTGS2	5743	1.496E-4	trans
rs1483373	chr8	90186442	PTGS2	5743	0	trans
rs11776005	chr8	90187416	PTGS2	5743	0	trans
rs1159499	chr8	90196948	PTGS2	5743	0.01	trans
rs1355060	chr8	118717710	PTGS2	5743	0	trans
rs2280828	chr8	118762435	PTGS2	5743	7.203E-4	trans
rs16901935	chr8	128076544	PTGS2	5743	0.08	trans
rs4976941	chr8	142744439	PTGS2	5743	1.339E-4	trans
rs9298651	chr9	10076275	PTGS2	5743	3.533E-5	trans
rs16931013	chr9	10076859	PTGS2	5743	3.533E-5	trans
rs16931018	chr9	10077048	PTGS2	5743	3.533E-5	trans
rs1467547	chr9	17630726	PTGS2	5743	0.02	trans
rs4415417	chr9	17837857	PTGS2	5743	0.03	trans
rs6476383	chr9	32865568	PTGS2	5743	0.01	trans
rs11143622	chr9	71370050	PTGS2	5743	0.01	trans
rs11143868	chr9	71437411	PTGS2	5743	0.06	trans
rs11143995	chr9	71462852	PTGS2	5743	0.06	trans
rs11144031	chr9	71477107	PTGS2	5743	0.06	trans
rs11791891	chr9	87512411	PTGS2	5743	0	trans
rs2165893	chr9	87531423	PTGS2	5743	0	trans
rs763623	chr9	87539663	PTGS2	5743	0.04	trans
rs3780642	chr9	87553144	PTGS2	5743	2.093E-6	trans
rs10992752	chr9	96240578	PTGS2	5743	0	trans
rs17785570	chr9	109691520	PTGS2	5743	0.15	trans
rs10981864	chr9	116416735	PTGS2	5743	0.11	trans
rs2771054	chr9	120302791	PTGS2	5743	0.11	trans
rs781331	chr9	120304378	PTGS2	5743	0.11	trans
snp_a-1879318		0	PTGS2	5743	0.08	trans
rs2807706	chr9	121744331	PTGS2	5743	4.562E-4	trans
rs2818297	chr9	121757015	PTGS2	5743	0	trans
rs6537944	chr9	137312827	PTGS2	5743	0.02	trans
rs11103132	chr9	138575901	PTGS2	5743	0.03	trans
rs6560840	chr10	489655	PTGS2	5743	0.07	trans
rs11252514	chr10	499572	PTGS2	5743	0	trans
rs2924269	chr10	4884783	PTGS2	5743	0.07	trans
rs11014370	chr10	25352798	PTGS2	5743	0.02	trans
rs772394	chr10	35980024	PTGS2	5743	0.01	trans
rs17432714	chr10	43526022	PTGS2	5743	0.1	trans
rs2853836	chr10	48431948	PTGS2	5743	0.03	trans
rs1908351	chr10	57877117	PTGS2	5743	0.01	trans
rs16911533	chr10	59756285	PTGS2	5743	0.19	trans
rs901309	chr10	72571899	PTGS2	5743	0.03	trans
rs884031	chr10	73104958	PTGS2	5743	0.11	trans
rs485305	chr10	116048044	PTGS2	5743	3.492E-4	trans
rs17540632	chr10	118774194	PTGS2	5743	0.18	trans
rs4750827	chr10	132547183	PTGS2	5743	0.02	trans
rs4750829	chr10	132547260	PTGS2	5743	0.03	trans
rs11021918	chr11	2269189	PTGS2	5743	0.03	trans
rs862785	chr11	20175604	PTGS2	5743	0.04	trans
rs16911034	chr11	23302320	PTGS2	5743	0.01	trans
rs10838551	chr11	46073112	PTGS2	5743	0.12	trans
rs10838567	chr11	46136342	PTGS2	5743	0.14	trans
rs12292520	chr11	48086150	PTGS2	5743	0.13	trans
rs17142688	chr11	81319064	PTGS2	5743	0.1	trans
rs11020043	chr11	92470587	PTGS2	5743	0.15	trans
rs10734162	chr11	93315762	PTGS2	5743	0.15	trans
rs2460047	chr11	93678935	PTGS2	5743	0.19	trans
rs1789300	chr11	95463631	PTGS2	5743	0	trans
rs1727152	chr11	95467435	PTGS2	5743	0.05	trans
rs1255149	chr11	95484493	PTGS2	5743	0	trans
rs3748251	chr11	95519156	PTGS2	5743	3.566E-4	trans
rs16922543	chr11	95526116	PTGS2	5743	3.566E-4	trans
rs16922622	chr11	95567387	PTGS2	5743	3.566E-4	trans
rs11219092	chr11	123130750	PTGS2	5743	0.06	trans
rs7119608	chr11	134922824	PTGS2	5743	0.02	trans
rs766095	chr12	1498432	PTGS2	5743	0.14	trans
rs733593	chr12	6636391	PTGS2	5743	0.01	trans
rs2058798	chr12	16743164	PTGS2	5743	0.08	trans
rs374484	chr12	27627159	PTGS2	5743	4.9E-4	trans
rs451921	chr12	27627499	PTGS2	5743	0.05	trans
rs10771436	chr12	28744556	PTGS2	5743	0.15	trans
rs8490	chr12	51453904	PTGS2	5743	4.89E-6	trans
rs1344796	chr12	76397104	PTGS2	5743	6.652E-5	trans
rs11831213	chr12	109895355	PTGS2	5743	0.05	trans
rs10850201	chr12	109903061	PTGS2	5743	0	trans
rs7133714	chr12	120141546	PTGS2	5743	0.14	trans
rs1885900	chr13	22676939	PTGS2	5743	0.08	trans
rs9581602	chr13	26834548	PTGS2	5743	0.08	trans
rs17084271	chr13	27089799	PTGS2	5743	0.03	trans
rs17084280	chr13	27090872	PTGS2	5743	0.03	trans
rs9569893	chr13	34198563	PTGS2	5743	0.06	trans
rs2408301	chr13	51808915	PTGS2	5743	0.17	trans
rs7982110	chr13	59723428	PTGS2	5743	4.62E-4	trans
rs9528250	chr13	61410190	PTGS2	5743	0.01	trans
rs7330331	chr13	67403122	PTGS2	5743	0	trans
rs17088392	chr13	72257235	PTGS2	5743	0.09	trans
rs7327697	chr13	83227456	PTGS2	5743	2.35E-4	trans
rs17667894	chr13	92014308	PTGS2	5743	0	trans
rs16950829	chr13	95894384	PTGS2	5743	0.18	trans
rs223110	chr14	23973042	PTGS2	5743	0.15	trans
rs7156088	chr14	27821865	PTGS2	5743	0	trans
rs7147321	chr14	45877904	PTGS2	5743	0.01	trans
rs1952728	chr14	45893091	PTGS2	5743	0.01	trans
rs17116137	chr14	45940865	PTGS2	5743	0.01	trans
rs7151829	chr14	45971281	PTGS2	5743	0.01	trans
rs8022005	chr14	61345380	PTGS2	5743	5.299E-4	trans
rs10148418	chr14	67003872	PTGS2	5743	0	trans
rs149642	chr14	72653498	PTGS2	5743	0.05	trans
rs3861624	chr14	78416193	PTGS2	5743	0.09	trans
rs17259772	chr14	88212617	PTGS2	5743	0.15	trans
rs17123832	chr14	88310442	PTGS2	5743	0.14	trans
rs4905035	chr14	93489262	PTGS2	5743	0.2	trans
rs941539	chr14	93561214	PTGS2	5743	0.04	trans
rs1885073	chr14	104357181	PTGS2	5743	9.61E-6	trans
rs4465541	chr14	105016846	PTGS2	5743	0.06	trans
rs16973929	chr15	47395709	PTGS2	5743	0.01	trans
rs8039808	chr15	49939845	PTGS2	5743	0.09	trans
rs10518936	chr15	58090522	PTGS2	5743	0.05	trans
rs2414703	chr15	61904602	PTGS2	5743	0.01	trans
rs289171	chr15	62576053	PTGS2	5743	0	trans
rs289161	chr15	62589888	PTGS2	5743	0	trans
rs4776998	chr15	68158544	PTGS2	5743	0.19	trans
rs11858762	chr15	81386594	PTGS2	5743	0.04	trans
rs9635390	chr15	90809632	PTGS2	5743	2.284E-5	trans
rs7174562	chr15	93811530	PTGS2	5743	0.06	trans
rs16948359	chr15	94233206	PTGS2	5743	0.15	trans
rs16948375	chr15	94236354	PTGS2	5743	0.04	trans
rs17140355	chr16	6548831	PTGS2	5743	0.04	trans
rs8047151	chr16	17209696	PTGS2	5743	1.006E-7	trans
rs4271578	chr16	17213886	PTGS2	5743	3.288E-6	trans
rs7200513	chr16	17219474	PTGS2	5743	0	trans
rs3829495	chr16	17221986	PTGS2	5743	2.174E-4	trans
rs7193763	chr16	17225534	PTGS2	5743	5.655E-5	trans
rs11861635	chr16	82543377	PTGS2	5743	0.14	trans
rs276966	chr16	86233753	PTGS2	5743	0.04	trans
rs1867231	chr17	13678834	PTGS2	5743	0.02	trans
rs9903086	chr17	39949515	PTGS2	5743	0.12	trans
rs7219986	chr17	53263206	PTGS2	5743	0.01	trans
rs17817797	chr17	53332496	PTGS2	5743	0	trans
rs16951770	chr18	7444826	PTGS2	5743	0.01	trans
rs2714380	chr18	25315312	PTGS2	5743	0.19	trans
rs2851752	chr18	25350684	PTGS2	5743	0.12	trans
rs7244394	chr18	32223105	PTGS2	5743	0.01	trans
snp_a-4248697		0	PTGS2	5743	0.04	trans
rs9950823	chr18	47526879	PTGS2	5743	0.13	trans
rs16951384	chr18	47527116	PTGS2	5743	0.02	trans
rs17064695	chr18	55956427	PTGS2	5743	0.07	trans
rs1469489	chr18	57228488	PTGS2	5743	0.12	trans
rs1469490	chr18	57229886	PTGS2	5743	0.18	trans
rs17074993	chr18	63260128	PTGS2	5743	0.02	trans
rs9319807	chr18	68766779	PTGS2	5743	0.05	trans
snp_a-1821751		0	PTGS2	5743	9.178E-4	trans
rs1942461	chr18	70509159	PTGS2	5743	0.01	trans
rs1942462	chr18	70509823	PTGS2	5743	0.01	trans
rs1942463	chr18	70509841	PTGS2	5743	0.01	trans
rs1942464	chr18	70509877	PTGS2	5743	0	trans
rs1942466	chr18	70517154	PTGS2	5743	0.01	trans
rs2156494	chr18	70518084	PTGS2	5743	0.01	trans
rs17056922	chr18	73086804	PTGS2	5743	0.03	trans
rs1540047	chr18	75047028	PTGS2	5743	0.07	trans
rs2850843	chr18	75048905	PTGS2	5743	0.07	trans
rs1540051	chr18	75049934	PTGS2	5743	0.02	trans
rs6603096	chr19	7415722	PTGS2	5743	0.04	trans
rs16980096	chr19	15000921	PTGS2	5743	0.09	trans
snp_a-2138575		0	PTGS2	5743	0.01	trans
rs8103530	chr19	39172219	PTGS2	5743	0.2	trans
rs234337	chr19	40458724	PTGS2	5743	0.01	trans
rs234363	chr19	40474607	PTGS2	5743	0	trans
rs6417634	chr20	6408617	PTGS2	5743	0.14	trans
rs6085552	chr20	6409004	PTGS2	5743	0.15	trans
rs16997215	chr20	16101890	PTGS2	5743	0.03	trans
snp_a-4254460		0	PTGS2	5743	0.06	trans
rs8113962	chr20	18995999	PTGS2	5743	0.15	trans
rs1797040	chr20	23907743	PTGS2	5743	0.02	trans
rs2424603		0	PTGS2	5743	0.02	trans
rs6102879	chr20	41138766	PTGS2	5743	0.04	trans
rs6026122	chr20	56769083	PTGS2	5743	0	trans
rs259991	chr20	57728347	PTGS2	5743	0.05	trans
rs6015452	chr20	57782312	PTGS2	5743	0.03	trans
rs6124034	chr20	59517206	PTGS2	5743	0.03	trans
rs6124036	chr20	59517478	PTGS2	5743	0.03	trans
rs4812237	chr20	59518040	PTGS2	5743	0.01	trans
rs2847443	chr21	14595263	PTGS2	5743	0.1	trans
rs2226440	chr21	18066174	PTGS2	5743	0.16	trans
rs16992859	chr21	36507007	PTGS2	5743	0.03	trans
rs2834872	chr21	36634845	PTGS2	5743	0.01	trans
rs2834874	chr21	36641270	PTGS2	5743	0.05	trans
rs2834875	chr21	36656119	PTGS2	5743	0	trans
rs877910	chr21	36658376	PTGS2	5743	0.01	trans
rs7284012	chr21	36664376	PTGS2	5743	0.09	trans
rs6586271	chr21	44362641	PTGS2	5743	0.11	trans
rs369613	chr22	22380717	PTGS2	5743	0.05	trans
rs410285	chr22	22381767	PTGS2	5743	0.05	trans
rs134028	chr22	28048448	PTGS2	5743	2.566E-5	trans
rs5762317	chr22	28094988	PTGS2	5743	0	trans
rs9968025	chr22	32321588	PTGS2	5743	0.11	trans
rs2179340	chr22	35192153	PTGS2	5743	0.12	trans
rs5768165	chr22	48318197	PTGS2	5743	0.06	trans
rs5768168	chr22	48319334	PTGS2	5743	0.06	trans
rs5768173	chr22	48321475	PTGS2	5743	0.06	trans
rs16978981	chrX	13538144	PTGS2	5743	0.02	trans
rs7879159	chrX	19481591	PTGS2	5743	0.02	trans
rs12006821	chrX	50424687	PTGS2	5743	0.03	trans
rs5977652	chrX	131315199	PTGS2	5743	0.18	trans
rs16992781	chrX	146460376	PTGS2	5743	0.03	trans
rs4824295	chrX	146496881	PTGS2	5743	0.01	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PLCB4	0.86	0.81
CYLD	0.84	0.78
AKAP2	0.84	0.75
MTMR7	0.84	0.86
PHACTR2	0.83	0.64
TBK1	0.82	0.79
PALM2-AKAP2	0.82	0.77
ADAM23	0.82	0.77
KCNH5	0.81	0.71
TLK1	0.81	0.76

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
EFEMP2	-0.42	-0.57
RAB34	-0.38	-0.55
GATSL3	-0.37	-0.53
CLEC3B	-0.37	-0.55
SLC2A4RG	-0.37	-0.49
C16orf74	-0.36	-0.53
EIF4EBP3	-0.36	-0.52
C1orf61	-0.36	-0.62
CSAG1	-0.36	-0.49
METRN	-0.35	-0.52

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004601	peroxidase activity	EXP		4514999
GO:0004601	peroxidase activity	IEA		-
GO:0004601	peroxidase activity	NAS		14511332
GO:0005506	iron ion binding	IEA		-
GO:0004666	prostaglandin-endoperoxide synthase activity	IEA		-
GO:0004666	prostaglandin-endoperoxide synthase activity	NAS		14511332
GO:0020037	heme binding	IEA		-
GO:0016702	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	IEA		-
GO:0016491	oxidoreductase activity	IEA		-
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008217	regulation of blood pressure	IEA		-
GO:0008217	regulation of blood pressure	ISS		-
GO:0006979	response to oxidative stress	IEA		-
GO:0006928	cell motion	TAS		9630216
GO:0006633	fatty acid biosynthetic process	IEA		-
GO:0019371	cyclooxygenase pathway	NAS		14511332
GO:0042640	anagen	IEA		-
GO:0050727	regulation of inflammatory response	NAS		14511332
GO:0055114	oxidation reduction	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005792	microsome	IEA		-
GO:0005788	endoplasmic reticulum lumen	EXP		4514999
GO:0005789	endoplasmic reticulum membrane	IEA		-
GO:0005634	nucleus	ISS		-
GO:0005737	cytoplasm	IDA		14511332
GO:0005737	cytoplasm	IEA		-
GO:0005737	cytoplasm	ISS		-
GO:0005783	endoplasmic reticulum	IEA		-
GO:0016020	membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ARACHIDONIC ACID METABOLISM	58	36	All SZGR 2.0 genes in this pathway
KEGG VEGF SIGNALING PATHWAY	76	53	All SZGR 2.0 genes in this pathway
KEGG LEISHMANIA INFECTION	72	56	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG SMALL CELL LUNG CANCER	84	67	All SZGR 2.0 genes in this pathway
BIOCARTA PPARA PATHWAY	58	43	All SZGR 2.0 genes in this pathway
PID NFAT TFPATHWAY	47	39	All SZGR 2.0 genes in this pathway
PID S1P S1P1 PATHWAY	21	18	All SZGR 2.0 genes in this pathway
PID CMYB PATHWAY	84	61	All SZGR 2.0 genes in this pathway
PID P38 ALPHA BETA DOWNSTREAM PATHWAY	38	29	All SZGR 2.0 genes in this pathway
PID TCR CALCIUM PATHWAY	29	23	All SZGR 2.0 genes in this pathway
REACTOME BIOLOGICAL OXIDATIONS	139	91	All SZGR 2.0 genes in this pathway
REACTOME PHASE1 FUNCTIONALIZATION OF COMPOUNDS	70	50	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN	634	384	All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA UP	294	178	All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP	408	247	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP	485	293	All SZGR 2.0 genes in this pathway
PUIFFE INVASION INHIBITED BY ASCITES DN	145	91	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN	455	304	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN	460	312	All SZGR 2.0 genes in this pathway
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP	233	161	All SZGR 2.0 genes in this pathway
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS MAGENTA UP	28	18	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 3D UP	182	110	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D UP	157	91	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D UP	194	122	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 16D UP	175	108	All SZGR 2.0 genes in this pathway
AKL HTLV1 INFECTION DN	68	41	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 2HR DN	88	53	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP	544	308	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LPS UP	431	237	All SZGR 2.0 genes in this pathway
GRAHAM CML QUIESCENT VS NORMAL DIVIDING UP	57	33	All SZGR 2.0 genes in this pathway
GRAHAM NORMAL QUIESCENT VS NORMAL DIVIDING UP	66	47	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES CD4 UP	64	46	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN	508	354	All SZGR 2.0 genes in this pathway
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS CDC25 DN	51	35	All SZGR 2.0 genes in this pathway
CHIN BREAST CANCER COPY NUMBER UP	27	18	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA FOREVER DN	31	23	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA UP	536	340	All SZGR 2.0 genes in this pathway
MISSIAGLIA REGULATED BY METHYLATION UP	126	78	All SZGR 2.0 genes in this pathway
DEBOSSCHER NFKB TARGETS REPRESSED BY GLUCOCORTICOIDS	24	18	All SZGR 2.0 genes in this pathway
AGARWAL AKT PATHWAY TARGETS	10	9	All SZGR 2.0 genes in this pathway
TSUNODA CISPLATIN RESISTANCE DN	51	38	All SZGR 2.0 genes in this pathway
WOOD EBV EBNA1 TARGETS DN	47	33	All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER UP	358	245	All SZGR 2.0 genes in this pathway
GALIE TUMOR ANGIOGENESIS	8	7	All SZGR 2.0 genes in this pathway
GROSS ELK3 TARGETS DN	32	17	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 DN	156	106	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP	769	437	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS DN	261	155	All SZGR 2.0 genes in this pathway
RICKMAN HEAD AND NECK CANCER C	113	47	All SZGR 2.0 genes in this pathway
WU CELL MIGRATION	184	114	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 40 HELA	42	29	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 60 MCF10A	39	24	All SZGR 2.0 genes in this pathway
AMIT SERUM RESPONSE 60 MCF10A	57	42	All SZGR 2.0 genes in this pathway
LIN SILENCED BY TUMOR MICROENVIRONMENT	108	73	All SZGR 2.0 genes in this pathway
SUNG METASTASIS STROMA UP	110	70	All SZGR 2.0 genes in this pathway
SHIN B CELL LYMPHOMA CLUSTER 6	11	9	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN	464	276	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 1 DN	169	102	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 3 DN	59	32	All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT UP	197	110	All SZGR 2.0 genes in this pathway
SMITH TERT TARGETS UP	145	91	All SZGR 2.0 genes in this pathway
GALINDO IMMUNE RESPONSE TO ENTEROTOXIN	85	67	All SZGR 2.0 genes in this pathway
STOSSI RESPONSE TO ESTRADIOL	50	35	All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION	475	313	All SZGR 2.0 genes in this pathway
NEMETH INFLAMMATORY RESPONSE LPS UP	88	64	All SZGR 2.0 genes in this pathway
HALMOS CEBPA TARGETS UP	52	34	All SZGR 2.0 genes in this pathway
NGUYEN NOTCH1 TARGETS DN	86	67	All SZGR 2.0 genes in this pathway
BRUNO HEMATOPOIESIS	66	48	All SZGR 2.0 genes in this pathway
LIANG SILENCED BY METHYLATION 2	53	34	All SZGR 2.0 genes in this pathway
LY AGING PREMATURE DN	30	17	All SZGR 2.0 genes in this pathway
ABE VEGFA TARGETS 2HR	34	21	All SZGR 2.0 genes in this pathway
SUZUKI RESPONSE TO TSA AND DECITABINE 1A	23	16	All SZGR 2.0 genes in this pathway
HARRIS HYPOXIA	81	64	All SZGR 2.0 genes in this pathway
CHANG IMMORTALIZED BY HPV31 DN	65	45	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK UP	244	151	All SZGR 2.0 genes in this pathway
ZHU CMV ALL UP	120	89	All SZGR 2.0 genes in this pathway
MCLACHLAN DENTAL CARIES DN	245	144	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS PEAK AT 2HR	51	36	All SZGR 2.0 genes in this pathway
ZHOU TNF SIGNALING 30MIN	54	36	All SZGR 2.0 genes in this pathway
JACKSON DNMT1 TARGETS UP	77	57	All SZGR 2.0 genes in this pathway
ABE VEGFA TARGETS	20	15	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV SCC UP	123	75	All SZGR 2.0 genes in this pathway
LY AGING OLD DN	56	35	All SZGR 2.0 genes in this pathway
LY AGING MIDDLE DN	16	10	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C3	20	15	All SZGR 2.0 genes in this pathway
ABE VEGFA TARGETS 30MIN	29	21	All SZGR 2.0 genes in this pathway
ZHU CMV 8 HR UP	47	39	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 9	92	59	All SZGR 2.0 genes in this pathway
MCLACHLAN DENTAL CARIES UP	253	147	All SZGR 2.0 genes in this pathway
BILD HRAS ONCOGENIC SIGNATURE	261	166	All SZGR 2.0 genes in this pathway
DURCHDEWALD SKIN CARCINOGENESIS DN	264	168	All SZGR 2.0 genes in this pathway
SANSOM WNT PATHWAY REQUIRE MYC	58	43	All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE DN	409	268	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP	602	364	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP	601	369	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP	430	288	All SZGR 2.0 genes in this pathway
HOQUE METHYLATED IN CANCER	56	45	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BONE DN	315	197	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B DN	564	326	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP	648	398	All SZGR 2.0 genes in this pathway
MATZUK OVULATION	14	10	All SZGR 2.0 genes in this pathway
MATZUK IMPLANTATION AND UTERINE	22	15	All SZGR 2.0 genes in this pathway
LABBE TGFB1 TARGETS UP	102	64	All SZGR 2.0 genes in this pathway
LABBE TARGETS OF TGFB1 AND WNT3A UP	111	70	All SZGR 2.0 genes in this pathway
CHEN HOXA5 TARGETS 9HR UP	223	132	All SZGR 2.0 genes in this pathway
MATTHEWS AP1 TARGETS	17	12	All SZGR 2.0 genes in this pathway
WINTER HYPOXIA METAGENE	242	168	All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS UP	165	118	All SZGR 2.0 genes in this pathway
FERRARI RESPONSE TO FENRETINIDE UP	22	16	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN	442	275	All SZGR 2.0 genes in this pathway
TAVAZOIE METASTASIS	108	68	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER HEPATOBLAST	16	12	All SZGR 2.0 genes in this pathway
SCHOEN NFKB SIGNALING	34	26	All SZGR 2.0 genes in this pathway
LI PROSTATE CANCER EPIGENETIC	30	22	All SZGR 2.0 genes in this pathway
UZONYI RESPONSE TO LEUKOTRIENE AND THROMBIN	37	26	All SZGR 2.0 genes in this pathway
TIAN TNF SIGNALING VIA NFKB	28	21	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN	306	191	All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G28	20	11	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 4HR UP	55	41	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS SENESCENT	572	352	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B	549	316	All SZGR 2.0 genes in this pathway
AZARE NEOPLASTIC TRANSFORMATION BY STAT3 UP	121	70	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN	882	538	All SZGR 2.0 genes in this pathway
WINZEN DEGRADED VIA KHSRP	100	70	All SZGR 2.0 genes in this pathway
KUWANO RNA STABILIZED BY NO	7	7	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 1HR UP	34	26	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR UP	199	143	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 COMPLETE	227	151	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM A	182	108	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway
GHANDHI DIRECT IRRADIATION UP	110	68	All SZGR 2.0 genes in this pathway
GHANDHI BYSTANDER IRRADIATION UP	86	54	All SZGR 2.0 genes in this pathway
ZWANG CLASS 3 TRANSIENTLY INDUCED BY EGF	222	159	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	1737	1744	1A,m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-143	1711	1717	1A	hsa-miR-143^brain	UGAGAUGAAGCACUGUAGCUCA
miR-144	1738	1744	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-26	257	264	1A,m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	257	264	1A,m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PTGS2