Gene Page: LRFN2
Summary ?
| GeneID | 57497 |
| Symbol | LRFN2 |
| Synonyms | FIGLER2|KIAA1246|SALM1 |
| Description | leucine rich repeat and fibronectin type III domain containing 2 |
| Reference | MIM:612808|HGNC:HGNC:21226|Ensembl:ENSG00000156564|Ensembl:ENSG00000226454|HPRD:17444|Vega:OTTHUMG00000014662 |
| Gene type | protein-coding |
| Map location | 6p21.2-p21.1 |
| Pascal p-value | 0.027 |
| Sherlock p-value | 0.069 |
| eGene | Cerebellar Hemisphere Cerebellum |
| Support | Potential synaptic genes |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.033 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| BOSCO ALLERGEN INDUCED TH2 ASSOCIATED MODULE | 151 | 86 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-125/351 | 192 | 199 | 1A,m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
| hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
| miR-221/222 | 273 | 279 | m8 | hsa-miR-221brain | AGCUACAUUGUCUGCUGGGUUUC |
| hsa-miR-222brain | AGCUACAUCUGGCUACUGGGUCUC | ||||
| miR-24 | 224 | 230 | m8 | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
| miR-30-5p | 91 | 98 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
| hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
| hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
| hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
| hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.