Gene Page: XPO5

Summary ?
GeneID57510
SymbolXPO5
Synonymsexp5
Descriptionexportin 5
ReferenceMIM:607845|HGNC:HGNC:17675|Ensembl:ENSG00000124571|HPRD:06385|Vega:OTTHUMG00000014742
Gene typeprotein-coding
Map location6p21.1
Pascal p-value3.634E-5
Sherlock p-value0.03
Fetal beta1.472
DMG1 (# studies)
SupportAscano FMRP targets

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:vanEijk_2014Genome-wide DNA methylation analysisThis dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). 2
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
GSMA_IIEGenome scan meta-analysis (European-ancestry samples)Psr: 0.04433 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg26468274643544000XPO5;POLH2.721E-4-0.3290.038DMG:Wockner_2014
cg07099407643027930XPO50.0013.607DMG:vanEijk_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000049tRNA bindingIEA-
GO:0005515protein bindingIPI12702765 |17353931 
GO:0008565protein transporter activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006611protein export from nucleusIEA-
GO:0031047gene silencing by RNAIEA-
GO:0015031protein transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005737cytoplasmIEA-

Section IV. Protein-protein interaction annotation

InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
EEF1A1CCS-3 | CCS3 | EEF-1 | EEF1A | EF-Tu | EF1A | FLJ25721 | GRAF-1EF | HNGC:16303 | LENG7 | MGC102687 | MGC131894 | MGC16224 | PTI1 | eEF1A-1eukaryotic translation elongation factor 1 alpha 1-HPRD,BioGRID12426393 
FADDGIG3 | MGC8528 | MORT1Fas (TNFRSF6)-associated via death domain-HPRD12702765 
GSTK1GST13glutathione S-transferase kappa 1Affinity Capture-MSBioGRID17353931 
ILF3CBTF | DRBF | DRBP76 | MMP4 | MPHOSPH4 | MPP4 | NF-AT-90 | NF110 | NF90 | NFAR | NFAR-1 | NFAR2 | TCP110 | TCP80interleukin enhancer binding factor 3, 90kDa-HPRD,BioGRID11777942 
MAGEA6MAGE-3b | MAGE3B | MAGE6 | MGC52297melanoma antigen family A, 6Affinity Capture-MSBioGRID17353931 
NEK6SID6-1512NIMA (never in mitosis gene a)-related kinase 6Affinity Capture-MSBioGRID17353931 
NUP153HNUP153 | N153nucleoporin 153kDa-HPRD,BioGRID11777942 
NUP214CAIN | CAN | D9S46E | MGC104525 | N214nucleoporin 214kDa-HPRD,BioGRID11777942 
PHLDA3TIH1pleckstrin homology-like domain, family A, member 3Affinity Capture-MSBioGRID17353931 
PTP4A3PRL-3 | PRL-R | PRL3protein tyrosine phosphatase type IVA, member 3Affinity Capture-MSBioGRID17353931 
RANARA24 | Gsp1 | TC4RAN, member RAS oncogene family-HPRD,BioGRID11777942 
SERINC3AIGP1 | DIFF33 | SBBI99 | TDE | TDE1 | TMS-1serine incorporator 3Affinity Capture-MSBioGRID17353931 


Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
REACTOME MICRORNA MIRNA BIOGENESIS 239All SZGR 2.0 genes in this pathway
REACTOME REGULATORY RNA PATHWAYS 2612All SZGR 2.0 genes in this pathway
WINTER HYPOXIA UP 9257All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP 430232All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN 335193All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN 180101All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278748All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN 1375806All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER 747453All SZGR 2.0 genes in this pathway
HATADA METHYLATED IN LUNG CANCER UP 390236All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR 544307All SZGR 2.0 genes in this pathway
BILD MYC ONCOGENIC SIGNATURE 206117All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN 911527All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN 1011592All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE UP 393244All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN 543317All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN 593372All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN 591366All SZGR 2.0 genes in this pathway
TOYOTA TARGETS OF MIR34B AND MIR34C 463262All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 19721213All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN 882538All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/506888894m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-2912901296m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-34/44981881A,m8hsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC