Gene Page: SEMA6A
Summary ?
GeneID | 57556 |
Symbol | SEMA6A |
Synonyms | HT018|SEMA|SEMA6A1|SEMAQ|VIA |
Description | semaphorin 6A |
Reference | MIM:605885|HGNC:HGNC:10738|Ensembl:ENSG00000092421|HPRD:06906|Vega:OTTHUMG00000162987 |
Gene type | protein-coding |
Map location | 5q23.1 |
Pascal p-value | 0.257 |
DEG p-value | DEG:Zhao_2015:p=2.24e-05:q=0.0404 |
Fetal beta | 0.706 |
eGene | Hippocampus |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DEG:Zhao_2015 | RNA Sequencing analysis | Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder. | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Expression | Meta-analysis of gene expression | P value: 2.144 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004872 | receptor activity | IEA | - | |
GO:0005515 | protein binding | IPI | 10993894 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007411 | axon guidance | NAS | axon (GO term level: 13) | 10993894 |
GO:0007399 | nervous system development | NAS | neurite (GO term level: 5) | 10993894 |
GO:0007010 | cytoskeleton organization | NAS | 10993894 | |
GO:0009887 | organ morphogenesis | NAS | 10993894 | |
GO:0007166 | cell surface receptor linked signal transduction | NAS | 10993894 | |
GO:0006915 | apoptosis | NAS | 10993894 | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0030154 | cell differentiation | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0030424 | axon | NAS | neuron, axon, Neurotransmitter (GO term level: 6) | 10993894 |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0016021 | integral to membrane | NAS | 10993894 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME OTHER SEMAPHORIN INTERACTIONS | 15 | 14 | All SZGR 2.0 genes in this pathway |
REACTOME SEMAPHORIN INTERACTIONS | 68 | 53 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LIVE UP | 485 | 293 | All SZGR 2.0 genes in this pathway |
ODONNELL TFRC TARGETS UP | 456 | 228 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LPS UP | 431 | 237 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
CHEBOTAEV GR TARGETS UP | 77 | 62 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 3 DN | 229 | 142 | All SZGR 2.0 genes in this pathway |
LI CISPLATIN RESISTANCE DN | 35 | 20 | All SZGR 2.0 genes in this pathway |
SHI SPARC TARGETS UP | 24 | 17 | All SZGR 2.0 genes in this pathway |
KIM MYC AMPLIFICATION TARGETS UP | 201 | 127 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
GARCIA TARGETS OF FLI1 AND DAX1 UP | 57 | 34 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY UP | 236 | 139 | All SZGR 2.0 genes in this pathway |
BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
BHATTACHARYA EMBRYONIC STEM CELL | 89 | 60 | All SZGR 2.0 genes in this pathway |
HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
CHIARETTI ACUTE LYMPHOBLASTIC LEUKEMIA ZAP70 | 67 | 33 | All SZGR 2.0 genes in this pathway |
REN ALVEOLAR RHABDOMYOSARCOMA UP | 98 | 64 | All SZGR 2.0 genes in this pathway |
YAMAZAKI TCEB3 TARGETS UP | 175 | 116 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY UP | 86 | 48 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
STEARMAN LUNG CANCER EARLY VS LATE DN | 61 | 39 | All SZGR 2.0 genes in this pathway |
OSADA ASCL1 TARGETS UP | 46 | 30 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL DN | 216 | 143 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS CTNNB1 DN | 170 | 105 | All SZGR 2.0 genes in this pathway |
WOO LIVER CANCER RECURRENCE UP | 105 | 75 | All SZGR 2.0 genes in this pathway |
NAKAYAMA SOFT TISSUE TUMORS PCA1 DN | 74 | 47 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA CLASSICAL | 162 | 122 | All SZGR 2.0 genes in this pathway |
CHYLA CBFA2T3 TARGETS DN | 242 | 146 | All SZGR 2.0 genes in this pathway |
KASLER HDAC7 TARGETS 2 DN | 32 | 23 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
NABA ECM AFFILIATED | 171 | 89 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 1306 | 1312 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 1305 | 1312 | 1A,m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA | ||||
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-128 | 568 | 574 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-132/212 | 3044 | 3050 | m8 | hsa-miR-212SZ | UAACAGUCUCCAGUCACGGCC |
hsa-miR-132brain | UAACAGUCUACAGCCAUGGUCG | ||||
miR-141/200a | 584 | 591 | 1A,m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG | ||||
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-144 | 566 | 572 | m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-145 | 813 | 820 | 1A,m8 | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
miR-15/16/195/424/497 | 1216 | 1222 | 1A | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-218 | 298 | 304 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU | ||||
miR-27 | 1273 | 1279 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC | ||||
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-30-5p | 2038 | 2044 | m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-331 | 3 | 9 | m8 | hsa-miR-331brain | GCCCCUGGGCCUAUCCUAGAA |
miR-338 | 1210 | 1216 | m8 | hsa-miR-338brain | UCCAGCAUCAGUGAUUUUGUUGA |
miR-375 | 2053 | 2059 | 1A | hsa-miR-375 | UUUGUUCGUUCGGCUCGCGUGA |
miR-377 | 1198 | 1204 | 1A | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
miR-496 | 1294 | 1301 | 1A,m8 | hsa-miR-496 | AUUACAUGGCCAAUCUC |
miR-503 | 1216 | 1222 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
miR-7 | 738 | 744 | 1A | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
miR-96 | 1540 | 1546 | m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.