SZGR2

Summary ?

GeneID	5786
Symbol	PTPRA
Synonyms	HEPTP\|HLPR\|HPTPA\|HPTPalpha\|LRP\|PTPA\|PTPRL2\|R-PTP-alpha\|RPTPA
Description	protein tyrosine phosphatase, receptor type A
Reference	MIM:176884\|HGNC:HGNC:9664\|Ensembl:ENSG00000132670\|HPRD:01476\|Vega:OTTHUMG00000031718
Gene type	protein-coding
Map location	20p13
Pascal p-value	0.036
Sherlock p-value	5.53E-4
Fetal beta	0.571
DMG	1 (# studies)
eGene	Myers' cis & trans
Support	TYROSINE KINASE SIGNALING

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	2
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0261

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg01048080	20	2853896	PTPRA	2.63E-8	-0.009	8.4E-6	DMG:Jaffe_2016
cg21457839	20	2854634	PTPRA	5.83E-8	-0.009	1.49E-5	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs879725	chr1	244406045	PTPRA	5786		0.15		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PIP5K1C	0.90	0.89
ABR	0.89	0.90
UNC13A	0.89	0.89
RHOBTB2	0.89	0.89
CLSTN1	0.87	0.88
PITPNM2	0.87	0.83
CHD5	0.87	0.85
TLN2	0.87	0.86
GARNL4	0.87	0.85
RIMBP2	0.86	0.84

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.49	-0.50
C1orf54	-0.48	-0.57
GNG11	-0.48	-0.56
C1orf61	-0.45	-0.52
AP002478.3	-0.44	-0.48
AF347015.31	-0.43	-0.47
RPS27L	-0.43	-0.45
SYCP3	-0.42	-0.50
CLEC2B	-0.42	-0.48
SAT1	-0.42	-0.49

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005001	transmembrane receptor protein tyrosine phosphatase activity	TAS		2169617
GO:0004872	receptor activity	IEA		-
GO:0016787	hydrolase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006468	protein amino acid phosphorylation	IEA		-
GO:0006470	protein amino acid dephosphorylation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016020	membrane	IEA		-
GO:0005887	integral to plasma membrane	TAS		2169617

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA SRCRPTP PATHWAY	11	9	All SZGR 2.0 genes in this pathway
ST WNT BETA CATENIN PATHWAY	34	28	All SZGR 2.0 genes in this pathway
PID INSULIN PATHWAY	45	32	All SZGR 2.0 genes in this pathway
PID INTEGRIN A4B1 PATHWAY	33	24	All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP	567	375	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN	508	354	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 2	127	92	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
PENG GLUTAMINE DEPRIVATION UP	38	25	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
MOOTHA HUMAN MITODB 6 2002	429	260	All SZGR 2.0 genes in this pathway
MOOTHA MITOCHONDRIA	447	277	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN	366	257	All SZGR 2.0 genes in this pathway
HOFFMANN PRE BI TO LARGE PRE BII LYMPHOCYTE UP	36	24	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN	457	302	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP	605	377	All SZGR 2.0 genes in this pathway
NAKAMURA ADIPOGENESIS LATE UP	104	67	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA CLASSICAL	162	122	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	311	317	1A	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-146	352	359	1A,m8	hsa-miR-146a	UGAGAACUGAAUUCCAUGGGUU
miR-146	352	359	1A,m8	hsa-miR-146b^brain	UGAGAACUGAAUUCCAUAGGCU
miR-218	344	351	1A,m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-495	59	65	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-496	151	157	1A	hsa-miR-496	AUUACAUGGCCAAUCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PTPRA