SZGR2

Summary ?

GeneID	5830
Symbol	PEX5
Synonyms	PBD2A\|PBD2B\|PTS1-BP\|PTS1R\|PXR1\|RCDP5
Description	peroxisomal biogenesis factor 5
Reference	MIM:600414\|HGNC:HGNC:9719\|Ensembl:ENSG00000139197\|HPRD:02684\|Vega:OTTHUMG00000168175
Gene type	protein-coding
Map location	12p13.31
Pascal p-value	0.05
Sherlock p-value	0.112
Fetal beta	-0.319
DMG	3 (# studies)
eGene	Anterior cingulate cortex BA24 Caudate basal ganglia Cortex Frontal Cortex BA9 Hippocampus Hypothalamus Nucleus accumbens basal ganglia Putamen basal ganglia Myers' cis & trans Meta
Support	Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	3
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	3
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	3
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg05236530	12	7362357	PEX5	5.888E-4	0.364	0.05	DMG:Wockner_2014
cg15754084	12	7343020	PEX5		-0.038	0.87	DMG:Nishioka_2013
cg07748017	12	7342621	PEX5	5.83E-8	-0.012	1.49E-5	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs2456470	chr15	62777955	PEX5	5830		0.19		trans
rs2053887	12	7346530	PEX5	ENSG00000139197.6	1.478E-6	0.01	5249	gtex_brain_ba24
rs12830671	12	7347278	PEX5	ENSG00000139197.6	8.763E-7	0.01	5997	gtex_brain_ba24
rs12820829	12	7347534	PEX5	ENSG00000139197.6	8.763E-7	0.01	6253	gtex_brain_ba24
rs61917956	12	7348659	PEX5	ENSG00000139197.6	4.544E-7	0.01	7378	gtex_brain_ba24
rs78613188	12	7348728	PEX5	ENSG00000139197.6	9.674E-8	0.01	7447	gtex_brain_ba24
rs200498082	12	7348907	PEX5	ENSG00000139197.6	1.518E-7	0.01	7626	gtex_brain_ba24
rs61917957	12	7349987	PEX5	ENSG00000139197.6	7.538E-7	0.01	8706	gtex_brain_ba24
rs200609395	12	7350135	PEX5	ENSG00000139197.6	7.415E-8	0.01	8854	gtex_brain_ba24
rs185073397	12	7350136	PEX5	ENSG00000139197.6	5.77E-7	0.01	8855	gtex_brain_ba24
rs7139158	12	7350155	PEX5	ENSG00000139197.6	1.011E-7	0.01	8874	gtex_brain_ba24
rs7962563	12	7353514	PEX5	ENSG00000139197.6	8.647E-7	0.01	12233	gtex_brain_ba24
rs10743271	12	7353790	PEX5	ENSG00000139197.6	1.326E-7	0.01	12509	gtex_brain_ba24
rs7315553	12	7353838	PEX5	ENSG00000139197.6	8.667E-7	0.01	12557	gtex_brain_ba24
rs12825629	12	7355583	PEX5	ENSG00000139197.6	8.702E-7	0.01	14302	gtex_brain_ba24
rs6486910	12	7356479	PEX5	ENSG00000139197.6	3.866E-7	0.01	15198	gtex_brain_ba24
rs6486911	12	7356494	PEX5	ENSG00000139197.6	3.874E-7	0.01	15213	gtex_brain_ba24
rs7970916	12	7357746	PEX5	ENSG00000139197.6	8.763E-7	0.01	16465	gtex_brain_ba24
rs75912799	12	7357897	PEX5	ENSG00000139197.6	8.763E-7	0.01	16616	gtex_brain_ba24
rs10161405	12	7358646	PEX5	ENSG00000139197.6	3.071E-7	0.01	17365	gtex_brain_ba24
rs10161542	12	7358684	PEX5	ENSG00000139197.6	3.071E-7	0.01	17403	gtex_brain_ba24
rs11044332	12	7358768	PEX5	ENSG00000139197.6	8.763E-7	0.01	17487	gtex_brain_ba24
rs111408486	12	7359175	PEX5	ENSG00000139197.6	8.763E-7	0.01	17894	gtex_brain_ba24
rs397737333	12	7359309	PEX5	ENSG00000139197.6	8.763E-7	0.01	18028	gtex_brain_ba24
rs3825405	12	7360143	PEX5	ENSG00000139197.6	8.763E-7	0.01	18862	gtex_brain_ba24
rs3816424	12	7360229	PEX5	ENSG00000139197.6	1.42E-7	0.01	18948	gtex_brain_ba24
rs1057225	12	7363574	PEX5	ENSG00000139197.6	8.763E-7	0.01	22293	gtex_brain_ba24
rs11448434	12	7363943	PEX5	ENSG00000139197.6	1.015E-8	0.01	22662	gtex_brain_ba24
rs4329748	12	7364442	PEX5	ENSG00000139197.6	8.763E-7	0.01	23161	gtex_brain_ba24
rs4492891	12	7364789	PEX5	ENSG00000139197.6	1.497E-6	0.01	23508	gtex_brain_ba24
rs200081407	12	7366581	PEX5	ENSG00000139197.6	8.857E-7	0.01	25300	gtex_brain_ba24
rs12228393	12	7368182	PEX5	ENSG00000139197.6	8.763E-7	0.01	26901	gtex_brain_ba24
rs10161170	12	7368629	PEX5	ENSG00000139197.6	1.422E-7	0.01	27348	gtex_brain_ba24
rs11044901	12	7368691	PEX5	ENSG00000139197.6	1.413E-7	0.01	27410	gtex_brain_ba24
rs10161103	12	7369087	PEX5	ENSG00000139197.6	1.42E-7	0.01	27806	gtex_brain_ba24
rs7969508	12	7370502	PEX5	ENSG00000139197.6	1.427E-7	0.01	29221	gtex_brain_ba24
rs7969635	12	7370612	PEX5	ENSG00000139197.6	1.427E-7	0.01	29331	gtex_brain_ba24
rs7969751	12	7370702	PEX5	ENSG00000139197.6	1.423E-7	0.01	29421	gtex_brain_ba24
rs7962917	12	7317194	PEX5	ENSG00000139197.6	1.276E-8	0	-24087	gtex_brain_putamen_basal
rs1450962	12	7320545	PEX5	ENSG00000139197.6	2.133E-10	0	-20736	gtex_brain_putamen_basal
rs12828040	12	7326541	PEX5	ENSG00000139197.6	1.997E-10	0	-14740	gtex_brain_putamen_basal
rs7310539	12	7329996	PEX5	ENSG00000139197.6	2.435E-10	0	-11285	gtex_brain_putamen_basal
rs111377129	12	7331606	PEX5	ENSG00000139197.6	1.413E-6	0	-9675	gtex_brain_putamen_basal
rs1839622	12	7334534	PEX5	ENSG00000139197.6	2.247E-10	0	-6747	gtex_brain_putamen_basal
rs7973719	12	7334813	PEX5	ENSG00000139197.6	6.325E-10	0	-6468	gtex_brain_putamen_basal
rs12828421	12	7335217	PEX5	ENSG00000139197.6	2.079E-10	0	-6064	gtex_brain_putamen_basal
rs12816419	12	7335420	PEX5	ENSG00000139197.6	6.331E-10	0	-5861	gtex_brain_putamen_basal
rs397742110	12	7336926	PEX5	ENSG00000139197.6	5.252E-10	0	-4355	gtex_brain_putamen_basal
rs397851127	12	7338793	PEX5	ENSG00000139197.6	9.714E-9	0	-2488	gtex_brain_putamen_basal
rs61917955	12	7338947	PEX5	ENSG00000139197.6	1.839E-10	0	-2334	gtex_brain_putamen_basal
rs12227917	12	7342343	PEX5	ENSG00000139197.6	2.655E-10	0	1062	gtex_brain_putamen_basal
rs200807978	12	7342364	PEX5	ENSG00000139197.6	3.05E-9	0	1083	gtex_brain_putamen_basal
rs201786247	12	7342367	PEX5	ENSG00000139197.6	1.249E-6	0	1086	gtex_brain_putamen_basal
rs200032511	12	7342371	PEX5	ENSG00000139197.6	6.54E-7	0	1090	gtex_brain_putamen_basal
rs12424618	12	7344802	PEX5	ENSG00000139197.6	1.258E-11	0	3521	gtex_brain_putamen_basal
rs2053887	12	7346530	PEX5	ENSG00000139197.6	4.144E-12	0	5249	gtex_brain_putamen_basal
rs12830671	12	7347278	PEX5	ENSG00000139197.6	2.807E-12	0	5997	gtex_brain_putamen_basal
rs12820829	12	7347534	PEX5	ENSG00000139197.6	2.799E-12	0	6253	gtex_brain_putamen_basal
rs61917956	12	7348659	PEX5	ENSG00000139197.6	3.767E-12	0	7378	gtex_brain_putamen_basal
rs78613188	12	7348728	PEX5	ENSG00000139197.6	1.218E-11	0	7447	gtex_brain_putamen_basal
rs200897876	12	7348841	PEX5	ENSG00000139197.6	1.086E-8	0	7560	gtex_brain_putamen_basal
rs200264446	12	7348912	PEX5	ENSG00000139197.6	2.823E-7	0	7631	gtex_brain_putamen_basal
rs181450002	12	7349108	PEX5	ENSG00000139197.6	1.562E-8	0	7827	gtex_brain_putamen_basal
rs186088555	12	7349135	PEX5	ENSG00000139197.6	3.921E-7	0	7854	gtex_brain_putamen_basal
rs183222544	12	7349162	PEX5	ENSG00000139197.6	1.979E-9	0	7881	gtex_brain_putamen_basal
rs61917957	12	7349987	PEX5	ENSG00000139197.6	2.169E-9	0	8706	gtex_brain_putamen_basal
rs71067161	12	7350013	PEX5	ENSG00000139197.6	7.964E-10	0	8732	gtex_brain_putamen_basal
rs117028872	12	7350028	PEX5	ENSG00000139197.6	1.328E-6	0	8747	gtex_brain_putamen_basal
rs79081846	12	7350052	PEX5	ENSG00000139197.6	9.669E-10	0	8771	gtex_brain_putamen_basal
rs200609395	12	7350135	PEX5	ENSG00000139197.6	3.462E-8	0	8854	gtex_brain_putamen_basal
rs185073397	12	7350136	PEX5	ENSG00000139197.6	5.01E-7	0	8855	gtex_brain_putamen_basal
rs7139158	12	7350155	PEX5	ENSG00000139197.6	2.458E-8	0	8874	gtex_brain_putamen_basal
rs78964892	12	7352735	PEX5	ENSG00000139197.6	6.008E-10	0	11454	gtex_brain_putamen_basal
rs138686752	12	7352903	PEX5	ENSG00000139197.6	2.405E-12	0	11622	gtex_brain_putamen_basal
rs7973600	12	7353351	PEX5	ENSG00000139197.6	6.853E-14	0	12070	gtex_brain_putamen_basal
rs7962563	12	7353514	PEX5	ENSG00000139197.6	1.329E-13	0	12233	gtex_brain_putamen_basal
rs10743271	12	7353790	PEX5	ENSG00000139197.6	2.402E-10	0	12509	gtex_brain_putamen_basal
rs7315553	12	7353838	PEX5	ENSG00000139197.6	1.455E-13	0	12557	gtex_brain_putamen_basal
rs12825629	12	7355583	PEX5	ENSG00000139197.6	1.005E-13	0	14302	gtex_brain_putamen_basal
rs6486910	12	7356479	PEX5	ENSG00000139197.6	1.906E-13	0	15198	gtex_brain_putamen_basal
rs6486911	12	7356494	PEX5	ENSG00000139197.6	1.904E-13	0	15213	gtex_brain_putamen_basal
rs372666240	12	7356574	PEX5	ENSG00000139197.6	1.163E-6	0	15293	gtex_brain_putamen_basal
rs7970916	12	7357746	PEX5	ENSG00000139197.6	1.449E-13	0	16465	gtex_brain_putamen_basal
rs75912799	12	7357897	PEX5	ENSG00000139197.6	1.449E-13	0	16616	gtex_brain_putamen_basal
rs10161405	12	7358646	PEX5	ENSG00000139197.6	5.601E-8	0	17365	gtex_brain_putamen_basal
rs10161542	12	7358684	PEX5	ENSG00000139197.6	5.601E-8	0	17403	gtex_brain_putamen_basal
rs11044332	12	7358768	PEX5	ENSG00000139197.6	1.449E-13	0	17487	gtex_brain_putamen_basal
rs111408486	12	7359175	PEX5	ENSG00000139197.6	1.449E-13	0	17894	gtex_brain_putamen_basal
rs397737333	12	7359309	PEX5	ENSG00000139197.6	1.449E-13	0	18028	gtex_brain_putamen_basal
rs3825405	12	7360143	PEX5	ENSG00000139197.6	1.449E-13	0	18862	gtex_brain_putamen_basal
rs3816424	12	7360229	PEX5	ENSG00000139197.6	6.524E-10	0	18948	gtex_brain_putamen_basal
rs1057225	12	7363574	PEX5	ENSG00000139197.6	1.449E-13	0	22293	gtex_brain_putamen_basal
rs11448434	12	7363943	PEX5	ENSG00000139197.6	1.995E-9	0	22662	gtex_brain_putamen_basal
rs4329748	12	7364442	PEX5	ENSG00000139197.6	1.449E-13	0	23161	gtex_brain_putamen_basal
rs4512930	12	7364623	PEX5	ENSG00000139197.6	2.205E-13	0	23342	gtex_brain_putamen_basal
rs4492891	12	7364789	PEX5	ENSG00000139197.6	1.454E-13	0	23508	gtex_brain_putamen_basal
rs200081407	12	7366581	PEX5	ENSG00000139197.6	1.143E-9	0	25300	gtex_brain_putamen_basal
rs12228393	12	7368182	PEX5	ENSG00000139197.6	2.807E-12	0	26901	gtex_brain_putamen_basal
rs10161170	12	7368629	PEX5	ENSG00000139197.6	6.543E-10	0	27348	gtex_brain_putamen_basal
rs11044901	12	7368691	PEX5	ENSG00000139197.6	6.612E-10	0	27410	gtex_brain_putamen_basal
rs10161103	12	7369087	PEX5	ENSG00000139197.6	6.524E-10	0	27806	gtex_brain_putamen_basal
rs397830029	12	7369169	PEX5	ENSG00000139197.6	1.22E-12	0	27888	gtex_brain_putamen_basal
rs6487053	12	7369318	PEX5	ENSG00000139197.6	1.275E-12	0	28037	gtex_brain_putamen_basal
rs61919598	12	7370116	PEX5	ENSG00000139197.6	5.956E-7	0	28835	gtex_brain_putamen_basal
rs7969508	12	7370502	PEX5	ENSG00000139197.6	7.99E-10	0	29221	gtex_brain_putamen_basal
rs7969635	12	7370612	PEX5	ENSG00000139197.6	7.99E-10	0	29331	gtex_brain_putamen_basal
rs7969751	12	7370702	PEX5	ENSG00000139197.6	8E-10	0	29421	gtex_brain_putamen_basal
rs72098838	12	7371483	PEX5	ENSG00000139197.6	2.216E-7	0	30202	gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ATAD1	0.93	0.91
SLC30A9	0.92	0.91
RAB18	0.92	0.92
CUL2	0.92	0.89
STX12	0.92	0.91
FAM49B	0.92	0.90
USP33	0.92	0.90
C10orf88	0.91	0.90
PPP2CA	0.91	0.89
CCDC132	0.91	0.89

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MT-CO2	-0.74	-0.68
AF347015.33	-0.72	-0.66
AF347015.8	-0.71	-0.67
MT-CYB	-0.71	-0.66
FXYD1	-0.71	-0.68
AF347015.2	-0.71	-0.65
AF347015.26	-0.71	-0.66
HIGD1B	-0.69	-0.64
AF347015.31	-0.69	-0.65
AF347015.21	-0.69	-0.60

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		9653144 \|10837480
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001764	neuron migration	IEA	neuron (GO term level: 8)	-
GO:0021895	cerebral cortex neuron differentiation	IEA	neuron, Brain (GO term level: 9)	-
GO:0000038	very-long-chain fatty acid metabolic process	IEA		-
GO:0007006	mitochondrial membrane organization	IEA		-
GO:0048468	cell development	IEA		-
GO:0007031	peroxisome organization	IEA		-
GO:0007029	endoplasmic reticulum organization	IEA		-
GO:0006635	fatty acid beta-oxidation	IEA		-
GO:0015031	protein transport	IEA		-
GO:0040018	positive regulation of multicellular organism growth	IEA		-
GO:0021795	cerebral cortex cell migration	IEA		-
GO:0044255	cellular lipid metabolic process	IEA		-
GO:0050905	neuromuscular process	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005737	cytoplasm	IEA		-
GO:0005777	peroxisome	IEA		-
GO:0005778	peroxisomal membrane	IEA		-
GO:0016020	membrane	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ATM	AT1 \| ATA \| ATC \| ATD \| ATDC \| ATE \| DKFZp781A0353 \| MGC74674 \| TEL1 \| TELO1	ataxia telangiectasia mutated	-	HPRD,BioGRID	10567403
CAT	MGC138422 \| MGC138424	catalase	Two-hybrid	BioGRID	10567403
DDO	DASOX \| DDO-1 \| DDO-2 \| FLJ45203	D-aspartate oxidase	-	HPRD,BioGRID	9820813
HSPA1A	FLJ54303 \| FLJ54370 \| FLJ54392 \| FLJ54408 \| FLJ75127 \| HSP70-1 \| HSP70-1A \| HSP70I \| HSP72 \| HSPA1 \| HSPA1B	heat shock 70kDa protein 1A	-	HPRD	11415446
PDZK1	CAP70 \| CLAMP \| NHERF3 \| PDZD1	PDZ domain containing 1	Two-hybrid	BioGRID	16189514
PEX10	MGC1998 \| NALD \| RNF69	peroxisomal biogenesis factor 10	-	HPRD,BioGRID	10837480
PEX12	PAF-3	peroxisomal biogenesis factor 12	PEX12 interacts with PEX5.	BIND	12096124
PEX12	PAF-3	peroxisomal biogenesis factor 12	-	HPRD,BioGRID	10562279 \|10837480
PEX13	NALD \| ZWS	peroxisomal biogenesis factor 13	-	HPRD,BioGRID	8858165 \|11865044
PEX14	MGC12767 \| NAPP2 \| Pex14p \| dJ734G22.2	peroxisomal biogenesis factor 14	PEX14 interacts with PEX5.	BIND	12096124
PEX14	MGC12767 \| NAPP2 \| Pex14p \| dJ734G22.2	peroxisomal biogenesis factor 14	Reconstituted Complex Two-hybrid	BioGRID	10212238 \|10837480 \|11865044
PEX14	MGC12767 \| NAPP2 \| Pex14p \| dJ734G22.2	peroxisomal biogenesis factor 14	-	HPRD	10212238 \|11865044
PEX7	PTS2R \| RCDP1 \| RD	peroxisomal biogenesis factor 7	-	HPRD,BioGRID	11546814 \|11865044
PXMP3	PAF-1 \| PAF1 \| PEX2 \| PMP3 \| PMP35 \| RNF72	peroxisomal membrane protein 3, 35kDa	-	HPRD	10837480
SIRT3	SIR2L3	sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae)	Two-hybrid	BioGRID	16189514
SNUPN	KPNBL \| RNUT1 \| Snurportin1	snurportin 1	Two-hybrid	BioGRID	16169070

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG PEROXISOME	78	47	All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP	567	375	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN	526	357	All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN DN	241	146	All SZGR 2.0 genes in this pathway
LAIHO COLORECTAL CANCER SERRATED DN	86	47	All SZGR 2.0 genes in this pathway
GAL LEUKEMIC STEM CELL UP	133	78	All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 5	147	89	All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER LIT INT NETWORK	101	73	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
ZHAN V2 LATE DIFFERENTIATION GENES	45	34	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION MUSCLE UP	43	33	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN	911	527	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN	1011	592	All SZGR 2.0 genes in this pathway
YOSHIOKA LIVER CANCER EARLY RECURRENCE UP	40	23	All SZGR 2.0 genes in this pathway
ACOSTA PROLIFERATION INDEPENDENT MYC TARGETS UP	84	51	All SZGR 2.0 genes in this pathway
TERAO AOX4 TARGETS HG UP	28	20	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D	882	506	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND WITH H4K20ME1 MARK	145	82	All SZGR 2.0 genes in this pathway
ALFANO MYC TARGETS	239	156	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-141/200a	919	926	1A,m8	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	919	926	1A,m8	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-15/16/195/424/497	272	278	m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-29	269	275	m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-31	892	899	1A,m8	hsa-miR-31	AGGCAAGAUGCUGGCAUAGCUG
miR-361	330	336	m8	hsa-miR-361^brain	UUAUCAGAAUCUCCAGGGGUAC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PEX5