Summary ?
GeneID5913
SymbolRAPSN
SynonymsCMS11|CMS4C|FADS|RAPSYN|RNF205
Descriptionreceptor associated protein of the synapse
ReferenceMIM:601592|HGNC:HGNC:9863|Ensembl:ENSG00000165917|HPRD:03353|Vega:OTTHUMG00000166891
Gene typeprotein-coding
Map location11p11.2
Pascal p-value0.026
eGeneMeta

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0008270zinc ion bindingIEA-
GO:0033130acetylcholine receptor bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007268synaptic transmissionTASneuron, Synap, Neurotransmitter (GO term level: 6)8812503 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0031594neuromuscular junctionIEAneuron, axon, Synap, Neurotransmitter (GO term level: 3)-
GO:0045211postsynaptic membraneIEASynap, Neurotransmitter (GO term level: 5)-
GO:0005794Golgi apparatusIEA-
GO:0005856cytoskeletonIEA-
GO:0005737cytoplasmIEA-
GO:0005886plasma membraneIEA-
GO:0030054cell junctionIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
BIOCARTA AGR PATHWAY 3631All SZGR 2.0 genes in this pathway
BIOCARTA ACH PATHWAY 1613All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP 276165All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 UP 341197All SZGR 2.0 genes in this pathway
SHIPP DLBCL VS FOLLICULAR LYMPHOMA DN 4528All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA UP 9864All SZGR 2.0 genes in this pathway
COATES MACROPHAGE M1 VS M2 UP 8152All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS 425261All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP 857456All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-142-5p1811871Ahsa-miR-142-5pCAUAAAGUAGAAAGCACUAC