SZGR2

Summary ?

GeneID	6092
Symbol	ROBO2
Synonyms	SAX3
Description	roundabout guidance receptor 2
Reference	MIM:602431\|HGNC:HGNC:10250\|Ensembl:ENSG00000185008\|Vega:OTTHUMG00000158935
Gene type	protein-coding
Map location	3p12.3
Fetal beta	1.021
eGene	Myers' cis & trans
Support	CELL ADHESION AND TRANSSYNAPTIC SIGNALING

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.04047
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.04359
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 3

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs9882137	chr3	29494146	ROBO2	6092	0.02	trans
rs9882501	chr3	29494429	ROBO2	6092	0.16	trans
rs4491879	chr3	189373908	ROBO2	6092	0.05	trans
rs4505678	chr3	189374356	ROBO2	6092	0.08	trans
rs9368571	chr6	28677757	ROBO2	6092	0.17	trans
rs9257144	chr6	28729980	ROBO2	6092	0.11	trans
rs16894557	chr6	28999825	ROBO2	6092	0.01	trans
rs1503026	chr18	70842605	ROBO2	6092	0.16	trans
rs12326929	chr18	70864592	ROBO2	6092	0.1	trans
rs12327665	chr19	39622639	ROBO2	6092	0.07	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TUT1	0.99	0.95
EIF3H	0.98	0.93
IGBP1	0.97	0.94
EIF3L	0.97	0.95
NACA	0.96	0.95
AC005393.1	0.96	0.91
BTF3	0.96	0.97
RPS8	0.96	0.88
VPS72	0.96	0.93
RPL5	0.96	0.94

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
HLA-F	-0.70	-0.76
AIFM3	-0.68	-0.75
FBXO2	-0.68	-0.66
C5orf53	-0.67	-0.67
LDHD	-0.66	-0.67
TINAGL1	-0.65	-0.77
AF347015.27	-0.65	-0.81
ALDOC	-0.65	-0.68
CLU	-0.65	-0.68
PTH1R	-0.65	-0.69

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008046	axon guidance receptor activity	NAS	axon (GO term level: 6)	9458045
GO:0042802	identical protein binding	IDA		12504588
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007420	brain development	IEP	Brain (GO term level: 7)	10197527
GO:0050772	positive regulation of axonogenesis	IDA	axon, neurogenesis (GO term level: 14)	12504588
GO:0001657	ureteric bud development	IMP		15130495
GO:0007155	cell adhesion	IEA		-
GO:0007156	homophilic cell adhesion	IDA		12504588
GO:0006935	chemotaxis	IEA		-
GO:0007275	multicellular organismal development	IEA		-
GO:0030154	cell differentiation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-
GO:0009986	cell surface	IDA		12504588

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG AXON GUIDANCE	129	103	All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE	251	188	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ROBO RECEPTOR	30	26	All SZGR 2.0 genes in this pathway
LI CISPLATIN RESISTANCE DN	35	20	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN	428	306	All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY UP	250	168	All SZGR 2.0 genes in this pathway
DING LUNG CANCER BY MUTATION RATE	20	18	All SZGR 2.0 genes in this pathway
YAMASHITA LIVER CANCER STEM CELL UP	47	38	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF ICP WITH H3K4ME3 AND H3K27ME3	38	34	All SZGR 2.0 genes in this pathway
MIKKELSEN IPS ICP WITH H3K4ME3 AND H327ME3	126	83	All SZGR 2.0 genes in this pathway
KYNG WERNER SYNDROM AND NORMAL AGING DN	225	124	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN	306	191	All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS DN	115	73	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	513	520	1A,m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-130/301	428	434	m8	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-144	514	520	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-148/152	429	435	m8	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-153	296	303	1A,m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-18	190	196	1A	hsa-miR-18a	UAAGGUGCAUCUAGUGCAGAUA
miR-18	190	196	1A	hsa-miR-18b	UAAGGUGCAUCUAGUGCAGUUA
miR-181	493	499	m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-185	934	940	1A	hsa-miR-185^brain	UGGAGAGAAAGGCAGUUC
miR-19	427	433	m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	427	433	m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-218	453	460	1A,m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-23	495	502	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
				hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
				hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
				hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-25/32/92/363/367	76	82	m8	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-323	495	501	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-33	115	121	1A	hsa-miR-33	GUGCAUUGUAGUUGCAUUG
miR-33	115	121	1A	hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
miR-378	207	213	m8	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU
miR-448	297	303	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-496	121	127	1A	hsa-miR-496	AUUACAUGGCCAAUCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ROBO2