Gene Page: SEC14L1
Summary ?
GeneID | 6397 |
Symbol | SEC14L1 |
Synonyms | PRELID4A|SEC14L |
Description | SEC14 like lipid binding 1 |
Reference | MIM:601504|HGNC:HGNC:10698|Ensembl:ENSG00000129657|HPRD:03295|Vega:OTTHUMG00000177311 |
Gene type | protein-coding |
Map location | 17q25.2 |
Pascal p-value | 0.288 |
Sherlock p-value | 0.611 |
Fetal beta | -0.798 |
DMG | 3 (# studies) |
eGene | Myers' cis & trans |
Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 7 |
DMG:Montano_2016 | Genome-wide DNA methylation analysis | This dataset includes 172 replicated associations between CpGs with schizophrenia. | 7 |
DMG:vanEijk_2014 | Genome-wide DNA methylation analysis | This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). | 7 |
Expression | Meta-analysis of gene expression | P value: 1.526 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg11186858 | 17 | 75096382 | SEC14L1 | 4.93E-6 | 0.011 | 0.029 | DMG:Montano_2016 |
cg11597902 | 17 | 75096239 | SEC14L1 | 1.49E-5 | 0.01 | 0.054 | DMG:Montano_2016 |
cg20610950 | 17 | 75096202 | SEC14L1 | 7.93E-5 | 0.012 | 0.112 | DMG:Montano_2016 |
cg26547236 | 17 | 75136326 | SEC14L1 | 1.4E-8 | -0.017 | 5.44E-6 | DMG:Jaffe_2016 |
cg04452095 | 17 | 75315868 | SEC14L1 | 7.817E-4 | -4.44 | DMG:vanEijk_2014 | |
cg03330678 | 17 | 75316233 | SEC14L1 | 5.18E-5 | -4.793 | DMG:vanEijk_2014 | |
cg03330678 | 17 | 75316233 | SEC14L1 | 4.57E-5 | -5.707 | DMG:vanEijk_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs11695174 | chr2 | 9788314 | SEC14L1 | 6397 | 0.2 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ACIN1 | 0.93 | 0.92 |
LAS1L | 0.92 | 0.92 |
RBM6 | 0.92 | 0.93 |
ANKZF1 | 0.92 | 0.92 |
RBM5 | 0.92 | 0.92 |
TRPV1 | 0.92 | 0.93 |
CLK2 | 0.91 | 0.92 |
MICAL1 | 0.91 | 0.91 |
FNBP4 | 0.91 | 0.91 |
ANO8 | 0.90 | 0.90 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.31 | -0.70 | -0.79 |
B2M | -0.67 | -0.73 |
AF347015.27 | -0.67 | -0.76 |
IFI27 | -0.66 | -0.74 |
MT-CO2 | -0.66 | -0.76 |
COPZ2 | -0.65 | -0.71 |
C5orf53 | -0.64 | -0.65 |
MT-CYB | -0.63 | -0.72 |
HIGD1B | -0.63 | -0.74 |
PSMB9 | -0.63 | -0.70 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005488 | binding | TAS | 8697811 | |
GO:0005215 | transporter activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006810 | transport | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005794 | Golgi apparatus | TAS | 8697811 | |
GO:0005622 | intracellular | IEA | - | |
GO:0016020 | membrane | TAS | 8697811 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
TURASHVILI BREAST DUCTAL CARCINOMA VS DUCTAL NORMAL DN | 198 | 110 | All SZGR 2.0 genes in this pathway |
WILCOX RESPONSE TO PROGESTERONE UP | 152 | 90 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LIVE UP | 485 | 293 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LIVE DN | 384 | 220 | All SZGR 2.0 genes in this pathway |
DITTMER PTHLH TARGETS UP | 112 | 68 | All SZGR 2.0 genes in this pathway |
ODONNELL TFRC TARGETS UP | 456 | 228 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 6HR DN | 167 | 100 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
HAHTOLA MYCOSIS FUNGOIDES UP | 19 | 15 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS DN | 142 | 95 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 DN | 153 | 100 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER UP | 181 | 108 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS DN | 366 | 238 | All SZGR 2.0 genes in this pathway |
THEILGAARD NEUTROPHIL AT SKIN WOUND DN | 225 | 163 | All SZGR 2.0 genes in this pathway |
MCCLUNG COCAINE REWARD 5D | 79 | 62 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE DN | 123 | 76 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN | 287 | 208 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS DN | 105 | 63 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE DN | 274 | 165 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL DN | 216 | 143 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER GOOD SURVIVAL A12 | 317 | 177 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
ACOSTA PROLIFERATION INDEPENDENT MYC TARGETS DN | 116 | 74 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
FOSTER KDM1A TARGETS DN | 211 | 119 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 453 | 459 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-190 | 419 | 425 | 1A | hsa-miR-190 | UGAUAUGUUUGAUAUAUUAGGU |
miR-208 | 383 | 389 | 1A | hsa-miR-208 | AUAAGACGAGCAAAAAGCUUGU |
miR-218 | 178 | 184 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-23 | 516 | 523 | 1A,m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-323 | 516 | 522 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-499 | 383 | 389 | 1A | hsa-miR-499 | UUAAGACUUGCAGUGAUGUUUAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.