SZGR2

Summary ?

GeneID	6444
Symbol	SGCD
Synonyms	35DAG\|CMD1L\|DAGD\|SG-delta\|SGCDP\|SGD
Description	sarcoglycan delta
Reference	MIM:601411\|HGNC:HGNC:10807\|Ensembl:ENSG00000170624\|HPRD:03246\|Vega:OTTHUMG00000163445
Gene type	protein-coding
Map location	5q33.3
Pascal p-value	3.602E-4
Fetal beta	-1.815
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
GSMA_I	Genome scan meta-analysis	Psr: 0.0032
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.01718
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.00459

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs1507047	chr16	50932778	SGCD	6444		0.17		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
B4GALT5	0.93	0.95
SLAIN2	0.93	0.94
CLASP1	0.92	0.94
ZNF828	0.92	0.93
SEC31A	0.92	0.94
EXOC2	0.92	0.95
POLR3A	0.92	0.94
STAU1	0.92	0.93
WDR82	0.91	0.94
KBTBD6	0.91	0.94

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
FXYD1	-0.73	-0.86
AF347015.31	-0.71	-0.84
MT-CO2	-0.71	-0.86
AF347015.27	-0.71	-0.83
C5orf53	-0.71	-0.75
S100B	-0.71	-0.81
HSD17B14	-0.71	-0.78
AF347015.33	-0.70	-0.83
TSC22D4	-0.70	-0.77
AIFM3	-0.69	-0.74

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007010	cytoskeleton organization	IEA		-
GO:0007517	muscle development	TAS		8841194 \|8842738
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005856	cytoskeleton	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0016021	integral to membrane	IEA		-
GO:0005886	plasma membrane	TAS		8842738
GO:0016012	sarcoglycan complex	IEA		-
GO:0016012	sarcoglycan complex	TAS		8841194

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG HYPERTROPHIC CARDIOMYOPATHY HCM	85	65	All SZGR 2.0 genes in this pathway
KEGG ARRHYTHMOGENIC RIGHT VENTRICULAR CARDIOMYOPATHY ARVC	76	59	All SZGR 2.0 genes in this pathway
KEGG DILATED CARDIOMYOPATHY	92	68	All SZGR 2.0 genes in this pathway
KEGG VIRAL MYOCARDITIS	73	58	All SZGR 2.0 genes in this pathway
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP	351	230	All SZGR 2.0 genes in this pathway
NEWMAN ERCC6 TARGETS DN	39	24	All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL UP	146	99	All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER DN	232	154	All SZGR 2.0 genes in this pathway
MARKEY RB1 CHRONIC LOF UP	115	78	All SZGR 2.0 genes in this pathway
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP	207	128	All SZGR 2.0 genes in this pathway
EBAUER MYOGENIC TARGETS OF PAX3 FOXO1 FUSION	50	26	All SZGR 2.0 genes in this pathway
KIM MYC AMPLIFICATION TARGETS UP	201	127	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR DN	298	200	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR DN	178	121	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE DN	261	183	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 6	189	112	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL UP	260	174	All SZGR 2.0 genes in this pathway
CHANG CYCLING GENES	148	83	All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 AND H3K27ME3	137	85	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2	182	102	All SZGR 2.0 genes in this pathway
STAMBOLSKY TARGETS OF MUTATED TP53 UP	49	35	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT	567	365	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B	549	316	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway
KATSANOU ELAVL1 TARGETS DN	148	88	All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS DN	418	245	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	1292	1298	m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-124.1	1404	1411	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	1404	1410	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	1404	1410	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-137	5064	5070	m8	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-142-5p	2786	2792	1A	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-15/16/195/424/497	5018	5024	m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-199	55	61	m8	hsa-miR-199a	CCCAGUGUUCAGACUACCUGUUC
miR-199	55	61	m8	hsa-miR-199b	CCCAGUGUUUAGACUAUCUGUUC
miR-214	5016	5022	m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-218	1433	1439	m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-26	3104	3110	1A	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	3104	3110	1A	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-325	76	82	1A	hsa-miR-325	CCUAGUAGGUGUCCAGUAAGUGU
miR-326	3901	3907	1A	hsa-miR-326	CCUCUGGGCCCUUCCUCCAG
miR-33	1414	1420	m8	hsa-miR-33	GUGCAUUGUAGUUGCAUUG
miR-33	1414	1420	m8	hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
miR-331	1359	1365	1A	hsa-miR-331^brain	GCCCCUGGGCCUAUCCUAGAA
miR-335	1344	1350	m8	hsa-miR-335^brain	UCAAGAGCAAUAACGAAAAAUGU
miR-339	1357	1363	m8	hsa-miR-339	UCCCUGUCCUCCAGGAGCUCA
miR-361	4990	4996	1A	hsa-miR-361^brain	UUAUCAGAAUCUCCAGGGGUAC
miR-410	2788	2794	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-504	1327	1334	1A,m8	hsa-miR-504	AGACCCUGGUCUGCACUCUAU
miR-539	4965	4972	1A,m8	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU
miR-9	3179	3185	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SGCD