Gene Page: SKP1
Summary ?
| GeneID | 6500 |
| Symbol | SKP1 |
| Synonyms | EMC19|OCP-II|OCP2|SKP1A|TCEB1L|p19A |
| Description | S-phase kinase-associated protein 1 |
| Reference | MIM:601434|HGNC:HGNC:10899|HPRD:03255| |
| Gene type | protein-coding |
| Map location | 5q31 |
| Pascal p-value | 0.538 |
| Sherlock p-value | 0.099 |
| Fetal beta | 0.251 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans Meta |
| Support | INTRACELLULAR SIGNAL TRANSDUCTION |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Expression | Meta-analysis of gene expression | P value: 1.419 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg02717486 | 5 | 133512833 | SKP1 | 4.8E-6 | -0.339 | 0.01 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs1570589 | chr9 | 116874354 | SKP1 | 6500 | 0.15 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| RPS6KA1 | 0.73 | 0.80 |
| TMEM189 | 0.71 | 0.78 |
| LAMP1 | 0.70 | 0.81 |
| PLOD3 | 0.69 | 0.74 |
| C14orf49 | 0.69 | 0.66 |
| CHST6 | 0.67 | 0.62 |
| PRR5L | 0.67 | 0.69 |
| CD82 | 0.67 | 0.63 |
| GAL3ST1 | 0.67 | 0.58 |
| LITAF | 0.66 | 0.71 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| CLEC2B | -0.30 | -0.27 |
| SYCP3 | -0.30 | -0.40 |
| AP000679.1 | -0.29 | -0.29 |
| PLAC9 | -0.29 | -0.29 |
| CARD16 | -0.28 | -0.23 |
| FAM159B | -0.27 | -0.44 |
| GNG11 | -0.27 | -0.31 |
| NOX1 | -0.27 | -0.30 |
| IL32 | -0.27 | -0.36 |
| RPL9 | -0.26 | -0.33 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003674 | molecular_function | ND | - | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0005515 | protein binding | IPI | 14685242 |15070733 |17274640 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006511 | ubiquitin-dependent protein catabolic process | IEA | - | |
| GO:0008150 | biological_process | ND | - | |
| GO:0051437 | positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle | EXP | 12791267 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005829 | cytosol | EXP | 9660940 |12820959 |15469984 | |
| GO:0005575 | cellular_component | ND | - | |
| GO:0005654 | nucleoplasm | EXP | 11231585 | |
| GO:0019005 | SCF ubiquitin ligase complex | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| BTRC | BETA-TRCP | FBW1A | FBXW1 | FBXW1A | FWD1 | MGC4643 | bTrCP | bTrCP1 | betaTrCP | beta-transducin repeat containing | Affinity Capture-Western Reconstituted Complex Two-hybrid | BioGRID | 9660940 |10531035 |10644755 |10918611 |12609982 |
| BTRC | BETA-TRCP | FBW1A | FBXW1 | FBXW1A | FWD1 | MGC4643 | bTrCP | bTrCP1 | betaTrCP | beta-transducin repeat containing | Skp1 interacts with Fbw1a. | BIND | 10531035 |
| CACYBP | GIG5 | MGC87971 | PNAS-107 | RP1-102G20.6 | S100A6BP | SIP | calcyclin binding protein | - | HPRD,BioGRID | 11389839 |
| CCNA2 | CCN1 | CCNA | cyclin A2 | - | HPRD,BioGRID | 9858587 |
| CDCA3 | GRCC8 | MGC2577 | TOME-1 | cell division cycle associated 3 | - | HPRD,BioGRID | 12679038 |
| CDK9 | C-2k | CDC2L4 | CTK1 | PITALRE | TAK | cyclin-dependent kinase 9 | Affinity Capture-Western Reconstituted Complex | BioGRID | 11689688 |
| CTNNB1 | CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 | catenin (cadherin-associated protein), beta 1, 88kDa | Affinity Capture-Western | BioGRID | 11389839 |
| CUL1 | MGC149834 | MGC149835 | cullin 1 | - | HPRD | 9827542 |
| CUL1 | MGC149834 | MGC149835 | cullin 1 | Affinity Capture-Western | BioGRID | 9430629 |12609982 |12628165 |
| CUL1 | MGC149834 | MGC149835 | cullin 1 | SKP1A interacts with Cul1 [15-410] to form part of the Cul1-Rbx1-Skp1-F Boxskp2 Scf Ubiquitin Ligase complex. | BIND | 11961546 |
| CUL7 | KIAA0076 | dJ20C7.5 | cullin 7 | - | HPRD,BioGRID | 12481031 |
| FBXL11 | CXXC8 | DKFZp434M1735 | FBL11 | FBL7 | FLJ00115 | FLJ46431 | JHDM1A | KDM2A | KIAA1004 | LILINA | F-box and leucine-rich repeat protein 11 | An unspecified isoform of SKP1 interacts with FBL11. | BIND | 15070733 |
| FBXL2 | DKFZp564P0622 | FBL2 | FBL3 | F-box and leucine-rich repeat protein 2 | - | HPRD | 10508920 |
| FBXL2 | DKFZp564P0622 | FBL2 | FBL3 | F-box and leucine-rich repeat protein 2 | Skp1 interacts with Fbl2. | BIND | 10531037 |
| FBXL3 | FBL3 | FBL3A | FBXL3A | F-box and leucine-rich repeat protein 3 | Skp1 interacts with Fbl3a | BIND | 10531035 |
| FBXL3 | FBL3 | FBL3A | FBXL3A | F-box and leucine-rich repeat protein 3 | - | HPRD,BioGRID | 10531035 |
| FBXL4 | FBL4 | FBL5 | F-box and leucine-rich repeat protein 4 | Skp1 interacts with Fbl4. | BIND | 10531037 |
| FBXL4 | FBL4 | FBL5 | F-box and leucine-rich repeat protein 4 | - | HPRD,BioGRID | 10531037 |
| FBXL5 | FBL4 | FBL5 | FLR1 | F-box and leucine-rich repeat protein 5 | Skp1 interacts with Fbl5. | BIND | 10531037 |
| FBXL5 | FBL4 | FBL5 | FLR1 | F-box and leucine-rich repeat protein 5 | - | HPRD,BioGRID | 10531037 |
| FBXL7 | FBL6 | FBL7 | F-box and leucine-rich repeat protein 7 | An unspecified isoform of SKP1 interacts with FBL7. | BIND | 15070733 |
| FBXL8 | FBL8 | FLJ11278 | MGC19959 | F-box and leucine-rich repeat protein 8 | - | HPRD | 10531037 |
| FBXO17 | FBG4 | FBX26 | FBXO26 | FLJ11798 | FLJ25205 | Fbx17 | MGC9379 | F-box protein 17 | - | HPRD | 10531037 |
| FBXO18 | FBH1 | FLJ14590 | Fbx18 | MGC131916 | MGC141935 | MGC141937 | F-box protein, helicase, 18 | - | HPRD,BioGRID | 11956208 |
| FBXO18 | FBH1 | FLJ14590 | Fbx18 | MGC131916 | MGC141935 | MGC141937 | F-box protein, helicase, 18 | FBH1 interacts with SKP1. | BIND | 11956208 |
| FBXO2 | FBG1 | FBX2 | Fbs1 | NFB42 | F-box protein 2 | - | HPRD | 10531035 |
| FBXO3 | DKFZp564B092 | FBA | FBX3 | F-box protein 3 | Skp1 interacts with Fbx3. | BIND | 10531037 |
| FBXO32 | FLJ32424 | Fbx32 | MAFbx | MGC33610 | F-box protein 32 | - | HPRD,BioGRID | 11717410 |
| FBXO34 | CGI-301 | DKFZp547C162 | FLJ20725 | Fbx34 | MGC126434 | MGC126435 | F-box protein 34 | Two-hybrid | BioGRID | 16169070 |
| FBXO4 | DKFZp547N213 | FBX4 | FLJ10141 | F-box protein 4 | Skp1 interacts with Fbx4. | BIND | 10531035 |
| FBXO4 | DKFZp547N213 | FBX4 | FLJ10141 | F-box protein 4 | - | HPRD,BioGRID | 10531035 |
| FBXO41 | FLJ37709 | Fbx41 | F-box protein 41 | An unspecified isoform of SKP1 interacts with KIAA1940. | BIND | 15070733 |
| FBXO44 | DKFZp781J0852 | FBG3 | FBX30 | FBX6A | Fbx44 | Fbxo6a | MGC14140 | F-box protein 44 | - | HPRD,BioGRID | 10531035 |
| FBXO5 | EMI1 | FBX5 | Fbxo31 | F-box protein 5 | Reconstituted Complex Two-hybrid | BioGRID | 10531035 |
| FBXO5 | EMI1 | FBX5 | Fbxo31 | F-box protein 5 | Skp1 interacts with Fbx5. | BIND | 10531035 |
| FBXO6 | FBG2 | FBS2 | FBX6 | Fbx6b | F-box protein 6 | Skp1 interacts with Fbx6a. | BIND | 10531035 |
| FBXO7 | DKFZp686B08113 | FBX | FBX07 | FBX7 | PARK15 | PKPS | F-box protein 7 | Affinity Capture-Western Reconstituted Complex Two-hybrid | BioGRID | 10531035 |
| FBXO7 | DKFZp686B08113 | FBX | FBX07 | FBX7 | PARK15 | PKPS | F-box protein 7 | Skp1 interacts with Fbx7. | BIND | 10531037 |
| FBXO7 | DKFZp686B08113 | FBX | FBX07 | FBX7 | PARK15 | PKPS | F-box protein 7 | Skp1 interacts with Fbx7. | BIND | 10531035 |
| FBXO9 | DKFZp434C0118 | FBX9 | KIAA0936 | NY-REN-57 | VCIA1 | dJ341E18.2 | F-box protein 9 | - | HPRD | 10531035 |
| FBXW11 | BTRC2 | BTRCP2 | FBW1B | FBXW1B | Fbw11 | Hos | KIAA0696 | F-box and WD repeat domain containing 11 | Affinity Capture-Western | BioGRID | 10644755 |
| FBXW2 | FBW2 | Fwd2 | MGC117371 | Md6 | F-box and WD repeat domain containing 2 | Affinity Capture-Western Reconstituted Complex Two-hybrid | BioGRID | 10531035 |
| FBXW2 | FBW2 | Fwd2 | MGC117371 | Md6 | F-box and WD repeat domain containing 2 | Skp1 interacts with Fbw2. | BIND | 10531037 |
| FBXW2 | FBW2 | Fwd2 | MGC117371 | Md6 | F-box and WD repeat domain containing 2 | Skp1 interacts with Fbw2. | BIND | 10531035 |
| FBXW2 | FBW2 | Fwd2 | MGC117371 | Md6 | F-box and WD repeat domain containing 2 | An unspecified isoform of SKP1 interacts with FBW2. | BIND | 15070733 |
| FBXW4P1 | FBW3 | FBXW3 | SHFM3P1 | F-box and WD repeat domain containing 4 pseudogene 1 | An unspecified isoform of SKP1 interacts with FBW3. | BIND | 15070733 |
| FBXW7 | AGO | CDC4 | DKFZp686F23254 | FBW6 | FBW7 | FBX30 | FBXO30 | FBXW6 | FLJ16457 | SEL-10 | SEL10 | F-box and WD repeat domain containing 7 | - | HPRD,BioGRID | 11585921 |
| FBXW8 | FBW6 | FBW8 | FBX29 | FBXO29 | FBXW6 | MGC33534 | F-box and WD repeat domain containing 8 | An unspecified isoform of SKP1 interacts with an unspecified isoform of FBW6. | BIND | 15070733 |
| FBXW8 | FBW6 | FBW8 | FBX29 | FBXO29 | FBXW6 | MGC33534 | F-box and WD repeat domain containing 8 | Affinity Capture-Western | BioGRID | 12481031 |
| FBXW8 | FBW6 | FBW8 | FBX29 | FBXO29 | FBXW6 | MGC33534 | F-box and WD repeat domain containing 8 | - | HPRD | 10531037 |
| GPS1 | COPS1 | CSN1 | MGC71287 | G protein pathway suppressor 1 | - | HPRD | 11337588 |
| RBX1 | BA554C12.1 | MGC13357 | MGC1481 | RNF75 | ROC1 | ring-box 1 | Affinity Capture-Western | BioGRID | 12628165 |
| SIAH1 | FLJ08065 | HUMSIAH | Siah-1 | Siah-1a | hSIAH1 | seven in absentia homolog 1 (Drosophila) | - | HPRD | 11389839 |
| SKP2 | FBL1 | FBXL1 | FLB1 | MGC1366 | S-phase kinase-associated protein 2 (p45) | Skp2-Fbox interacts with SKP1A to form part of the Cul1-Rbx1-Skp1-F Boxskp2 Scf Ubiquitin Ligase complex. | BIND | 11961546 |
| SKP2 | FBL1 | FBXL1 | FLB1 | MGC1366 | S-phase kinase-associated protein 2 (p45) | - | HPRD | 9430629 |9827542|11099048 |
| SKP2 | FBL1 | FBXL1 | FLB1 | MGC1366 | S-phase kinase-associated protein 2 (p45) | Affinity Capture-Western Co-crystal Structure Reconstituted Complex Two-hybrid | BioGRID | 9827542 |10531035 |10559858 |10918611 |11099048 |12609982 |
| SUGT1 | SGT1 | SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae) | Reconstituted Complex | BioGRID | 12746458 |
| TBK1 | FLJ11330 | NAK | T2K | TANK-binding kinase 1 | Affinity Capture-MS | BioGRID | 14743216 |
| TBL1X | EBI | SMAP55 | TBL1 | transducin (beta)-like 1X-linked | - | HPRD,BioGRID | 11389839 |
| ZC3HC1 | 1110054L24Rik | HSPC216 | NIPA | zinc finger, C3HC-type containing 1 | NIPA interacts with an unspecified isoform Skp1. | BIND | 16009132 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG CELL CYCLE | 128 | 84 | All SZGR 2.0 genes in this pathway |
| KEGG OOCYTE MEIOSIS | 114 | 79 | All SZGR 2.0 genes in this pathway |
| KEGG UBIQUITIN MEDIATED PROTEOLYSIS | 138 | 98 | All SZGR 2.0 genes in this pathway |
| KEGG WNT SIGNALING PATHWAY | 151 | 112 | All SZGR 2.0 genes in this pathway |
| KEGG TGF BETA SIGNALING PATHWAY | 86 | 64 | All SZGR 2.0 genes in this pathway |
| BIOCARTA SKP2E2F PATHWAY | 10 | 6 | All SZGR 2.0 genes in this pathway |
| BIOCARTA P27 PATHWAY | 13 | 10 | All SZGR 2.0 genes in this pathway |
| PID NOTCH PATHWAY | 59 | 49 | All SZGR 2.0 genes in this pathway |
| PID BETA CATENIN DEG PATHWAY | 18 | 17 | All SZGR 2.0 genes in this pathway |
| PID BETA CATENIN NUC PATHWAY | 80 | 60 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY WNT | 65 | 41 | All SZGR 2.0 genes in this pathway |
| REACTOME CELL CYCLE | 421 | 253 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY ERBB4 | 90 | 67 | All SZGR 2.0 genes in this pathway |
| REACTOME PROLACTIN RECEPTOR SIGNALING | 14 | 11 | All SZGR 2.0 genes in this pathway |
| REACTOME NUCLEAR SIGNALING BY ERBB4 | 38 | 30 | All SZGR 2.0 genes in this pathway |
| REACTOME DOWNSTREAM SIGNALING EVENTS OF B CELL RECEPTOR BCR | 97 | 66 | All SZGR 2.0 genes in this pathway |
| REACTOME ACTIVATION OF NF KAPPAB IN B CELLS | 64 | 43 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY THE B CELL RECEPTOR BCR | 126 | 90 | All SZGR 2.0 genes in this pathway |
| REACTOME NOTCH1 INTRACELLULAR DOMAIN REGULATES TRANSCRIPTION | 46 | 28 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY NOTCH1 | 70 | 46 | All SZGR 2.0 genes in this pathway |
| REACTOME CELL CYCLE MITOTIC | 325 | 185 | All SZGR 2.0 genes in this pathway |
| REACTOME CYCLIN E ASSOCIATED EVENTS DURING G1 S TRANSITION | 65 | 40 | All SZGR 2.0 genes in this pathway |
| REACTOME G1 PHASE | 38 | 23 | All SZGR 2.0 genes in this pathway |
| REACTOME G1 S TRANSITION | 112 | 63 | All SZGR 2.0 genes in this pathway |
| REACTOME MITOTIC G1 G1 S PHASES | 137 | 79 | All SZGR 2.0 genes in this pathway |
| REACTOME REGULATION OF MITOTIC CELL CYCLE | 85 | 46 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY ILS | 107 | 86 | All SZGR 2.0 genes in this pathway |
| REACTOME IL1 SIGNALING | 39 | 30 | All SZGR 2.0 genes in this pathway |
| REACTOME CIRCADIAN CLOCK | 53 | 40 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY NOTCH | 103 | 64 | All SZGR 2.0 genes in this pathway |
| REACTOME HIV INFECTION | 207 | 122 | All SZGR 2.0 genes in this pathway |
| REACTOME HOST INTERACTIONS OF HIV FACTORS | 132 | 81 | All SZGR 2.0 genes in this pathway |
| REACTOME SCF BETA TRCP MEDIATED DEGRADATION OF EMI1 | 51 | 32 | All SZGR 2.0 genes in this pathway |
| REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
| REACTOME ADAPTIVE IMMUNE SYSTEM | 539 | 350 | All SZGR 2.0 genes in this pathway |
| REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM | 270 | 204 | All SZGR 2.0 genes in this pathway |
| REACTOME CLASS I MHC MEDIATED ANTIGEN PROCESSING PRESENTATION | 251 | 156 | All SZGR 2.0 genes in this pathway |
| REACTOME ANTIGEN PROCESSING UBIQUITINATION PROTEASOME DEGRADATION | 212 | 129 | All SZGR 2.0 genes in this pathway |
| REACTOME S PHASE | 109 | 66 | All SZGR 2.0 genes in this pathway |
| REACTOME SCFSKP2 MEDIATED DEGRADATION OF P27 P21 | 56 | 34 | All SZGR 2.0 genes in this pathway |
| PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| BORCZUK MALIGNANT MESOTHELIOMA UP | 305 | 185 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
| LANDIS ERBB2 BREAST PRENEOPLASTIC UP | 20 | 10 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
| LANDIS ERBB2 BREAST TUMORS 324 UP | 150 | 93 | All SZGR 2.0 genes in this pathway |
| LUI THYROID CANCER PAX8 PPARG DN | 45 | 29 | All SZGR 2.0 genes in this pathway |
| LUI TARGETS OF PAX8 PPARG FUSION | 34 | 23 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
| YANG BREAST CANCER ESR1 BULK UP | 27 | 15 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
| SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL AND BRAIN QTL CIS | 65 | 38 | All SZGR 2.0 genes in this pathway |
| DER IFN ALPHA RESPONSE UP | 74 | 48 | All SZGR 2.0 genes in this pathway |
| NING CHRONIC OBSTRUCTIVE PULMONARY DISEASE DN | 121 | 79 | All SZGR 2.0 genes in this pathway |
| DER IFN BETA RESPONSE UP | 102 | 67 | All SZGR 2.0 genes in this pathway |
| DER IFN GAMMA RESPONSE UP | 71 | 45 | All SZGR 2.0 genes in this pathway |
| PARK HSC AND MULTIPOTENT PROGENITORS | 50 | 33 | All SZGR 2.0 genes in this pathway |
| IGLESIAS E2F TARGETS UP | 151 | 103 | All SZGR 2.0 genes in this pathway |
| MCCLUNG CREB1 TARGETS DN | 57 | 39 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RESPONSE TO TRABECTEDIN UP | 71 | 49 | All SZGR 2.0 genes in this pathway |
| NATSUME RESPONSE TO INTERFERON BETA DN | 52 | 33 | All SZGR 2.0 genes in this pathway |
| LEE CALORIE RESTRICTION NEOCORTEX DN | 88 | 58 | All SZGR 2.0 genes in this pathway |
| DAZARD RESPONSE TO UV SCC UP | 123 | 75 | All SZGR 2.0 genes in this pathway |
| BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
| JIANG AGING CEREBRAL CORTEX DN | 54 | 43 | All SZGR 2.0 genes in this pathway |
| ALONSO METASTASIS UP | 198 | 128 | All SZGR 2.0 genes in this pathway |
| WANG TUMOR INVASIVENESS DN | 210 | 128 | All SZGR 2.0 genes in this pathway |
| VANTVEER BREAST CANCER ESR1 UP | 167 | 99 | All SZGR 2.0 genes in this pathway |
| VANTVEER BREAST CANCER BRCA1 DN | 44 | 28 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
| NIELSEN GIST | 98 | 66 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
| GREGORY SYNTHETIC LETHAL WITH IMATINIB | 145 | 83 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| PURBEY TARGETS OF CTBP1 NOT SATB1 UP | 344 | 215 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-130/301 | 50 | 56 | m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
| hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
| hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
| hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
| miR-145 | 420 | 427 | 1A,m8 | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
| miR-148/152 | 51 | 57 | m8 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
| hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
| hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
| miR-496 | 755 | 762 | 1A,m8 | hsa-miR-496 | AUUACAUGGCCAAUCUC |
| miR-7 | 471 | 478 | 1A,m8 | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.