Gene Page: SNRPB2
Summary ?
| GeneID | 6629 |
| Symbol | SNRPB2 |
| Synonyms | Msl1 |
| Description | small nuclear ribonucleoprotein polypeptide B |
| Reference | MIM:603520|HGNC:HGNC:11155|Ensembl:ENSG00000125870|HPRD:04628|Vega:OTTHUMG00000031933 |
| Gene type | protein-coding |
| Map location | 20p12.1 |
| Pascal p-value | 0.345 |
| Sherlock p-value | 0.619 |
| Fetal beta | 0.836 |
| DMG | 1 (# studies) |
| eGene | Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.046 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg06821919 | 20 | 16710653 | SNRPB2 | 4.333E-4 | -0.228 | 0.045 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0003723 | RNA binding | IEA | - | |
| GO:0005515 | protein binding | IPI | 17353931 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000398 | nuclear mRNA splicing, via spliceosome | EXP | 12226669 | |
| GO:0000398 | nuclear mRNA splicing, via spliceosome | IC | 9731529 | |
| GO:0008380 | RNA splicing | TAS | 2951739 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005681 | spliceosome | IDA | 9731529 | |
| GO:0005686 | snRNP U2 | TAS | 2951739 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG SPLICEOSOME | 128 | 72 | All SZGR 2.0 genes in this pathway |
| REACTOME PROCESSING OF CAPPED INTRON CONTAINING PRE MRNA | 140 | 77 | All SZGR 2.0 genes in this pathway |
| REACTOME MRNA PROCESSING | 161 | 86 | All SZGR 2.0 genes in this pathway |
| REACTOME MRNA SPLICING | 111 | 58 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| OUELLET OVARIAN CANCER INVASIVE VS LMP UP | 117 | 85 | All SZGR 2.0 genes in this pathway |
| RASHI RESPONSE TO IONIZING RADIATION 6 | 84 | 54 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
| GRUETZMANN PANCREATIC CANCER UP | 358 | 245 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
| SAKAI TUMOR INFILTRATING MONOCYTES DN | 81 | 51 | All SZGR 2.0 genes in this pathway |
| ROZANOV MMP14 CORRELATED | 11 | 9 | All SZGR 2.0 genes in this pathway |
| ROZANOV MMP14 TARGETS UP | 266 | 171 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL CIS | 128 | 77 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL AND BRAIN QTL CIS | 65 | 38 | All SZGR 2.0 genes in this pathway |
| TARTE PLASMA CELL VS PLASMABLAST DN | 309 | 206 | All SZGR 2.0 genes in this pathway |
| DER IFN GAMMA RESPONSE DN | 11 | 9 | All SZGR 2.0 genes in this pathway |
| PENG GLUTAMINE DEPRIVATION DN | 337 | 230 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
| BANDRES RESPONSE TO CARMUSTIN WITHOUT MGMT 24HR UP | 14 | 10 | All SZGR 2.0 genes in this pathway |
| ZHU CMV ALL UP | 120 | 89 | All SZGR 2.0 genes in this pathway |
| MODY HIPPOCAMPUS PRENATAL | 42 | 33 | All SZGR 2.0 genes in this pathway |
| BANDRES RESPONSE TO CARMUSTIN WITHOUT MGMT 48HR UP | 18 | 13 | All SZGR 2.0 genes in this pathway |
| ZHU CMV 24 HR UP | 93 | 65 | All SZGR 2.0 genes in this pathway |
| BANDRES RESPONSE TO CARMUSTIN MGMT 48HR UP | 18 | 13 | All SZGR 2.0 genes in this pathway |
| ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
| LEE LIVER CANCER SURVIVAL DN | 175 | 103 | All SZGR 2.0 genes in this pathway |
| ROME INSULIN TARGETS IN MUSCLE UP | 442 | 263 | All SZGR 2.0 genes in this pathway |
| SETLUR PROSTATE CANCER TMPRSS2 ERG FUSION UP | 67 | 48 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| BANDRES RESPONSE TO CARMUSTIN MGMT 24HR UP | 9 | 5 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| FEVR CTNNB1 TARGETS DN | 553 | 343 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-376 | 159 | 165 | 1A | hsa-miR-376a | AUCAUAGAGGAAAAUCCACGU |
| hsa-miR-376b | AUCAUAGAGGAAAAUCCAUGUU | ||||
| miR-493-5p | 184 | 190 | 1A | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.