Gene Page: STK10
Summary ?
| GeneID | 6793 |
| Symbol | STK10 |
| Synonyms | LOK|PRO2729 |
| Description | serine/threonine kinase 10 |
| Reference | MIM:603919|HGNC:HGNC:11388|Ensembl:ENSG00000072786|HPRD:06796|Vega:OTTHUMG00000163265 |
| Gene type | protein-coding |
| Map location | 5q35.1 |
| Pascal p-value | 0.48 |
| Sherlock p-value | 0.679 |
| Fetal beta | 0.474 |
| DMG | 2 (# studies) |
| eGene | Cerebellar Hemisphere Cerebellum Frontal Cortex BA9 Myers' cis & trans |
| Support | CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 3 |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 3 |
| DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.0276 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| STK10 | chr5 | 171517356 | A | G | NM_005990 | p.522L>P | missense | Schizophrenia | DNM:Fromer_2014 |
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg05962107 | 5 | 171615394 | STK10 | 1.415E-4 | -0.541 | 0.031 | DMG:Wockner_2014 |
| cg07665929 | 5 | 171523225 | STK10 | 5.595E-4 | 0.637 | 0.049 | DMG:Wockner_2014 |
| cg00156744 | 5 | 171615663 | STK10 | -0.019 | 0.87 | DMG:Nishioka_2013 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs6687849 | chr1 | 175904808 | STK10 | 6793 | 0.07 | trans | ||
| rs2481653 | chr1 | 176044120 | STK10 | 6793 | 0.09 | trans | ||
| rs2502827 | chr1 | 176044216 | STK10 | 6793 | 0 | trans | ||
| rs12405921 | chr1 | 206695730 | STK10 | 6793 | 0.09 | trans | ||
| rs16829545 | chr2 | 151977407 | STK10 | 6793 | 4.194E-20 | trans | ||
| rs16841750 | chr2 | 158288461 | STK10 | 6793 | 0.01 | trans | ||
| rs3845734 | chr2 | 171125572 | STK10 | 6793 | 1.354E-6 | trans | ||
| rs7584986 | chr2 | 184111432 | STK10 | 6793 | 8.925E-13 | trans | ||
| rs2183142 | chr4 | 159232695 | STK10 | 6793 | 0 | trans | ||
| rs170776 | chr4 | 173276735 | STK10 | 6793 | 0.13 | trans | ||
| rs1396222 | chr4 | 173279496 | STK10 | 6793 | 0.07 | trans | ||
| rs335980 | chr4 | 173329784 | STK10 | 6793 | 0.05 | trans | ||
| rs335982 | chr4 | 173330945 | STK10 | 6793 | 0.13 | trans | ||
| rs337984 | chr4 | 173411662 | STK10 | 6793 | 0.04 | trans | ||
| rs3111196 | chr5 | 54402889 | STK10 | 6793 | 0.08 | trans | ||
| rs17762315 | chr5 | 76807576 | STK10 | 6793 | 0 | trans | ||
| rs1380396 | chr5 | 100737044 | STK10 | 6793 | 0.15 | trans | ||
| rs6887062 | chr5 | 123850762 | STK10 | 6793 | 0.18 | trans | ||
| rs1368303 | chr5 | 147672388 | STK10 | 6793 | 0.04 | trans | ||
| rs9461864 | chr6 | 33481468 | STK10 | 6793 | 0.01 | trans | ||
| rs17511672 | chr6 | 107776429 | STK10 | 6793 | 0.17 | trans | ||
| rs7787830 | chr7 | 98797019 | STK10 | 6793 | 0.15 | trans | ||
| rs3118341 | chr9 | 25185518 | STK10 | 6793 | 1.237E-4 | trans | ||
| rs1126130 | chr9 | 25209346 | STK10 | 6793 | 0.03 | trans | ||
| rs1998746 | chr9 | 25211761 | STK10 | 6793 | 0.03 | trans | ||
| rs1332433 | chr9 | 25214440 | STK10 | 6793 | 0.08 | trans | ||
| rs9406868 | chr9 | 25223372 | STK10 | 6793 | 0.03 | trans | ||
| rs17104720 | chr14 | 77127308 | STK10 | 6793 | 0.16 | trans | ||
| rs16955618 | chr15 | 29937543 | STK10 | 6793 | 1.52E-32 | trans | ||
| rs16945437 | chr17 | 11797650 | STK10 | 6793 | 0.1 | trans | ||
| rs11873184 | chr18 | 1584081 | STK10 | 6793 | 0.08 | trans | ||
| rs11882889 | chr19 | 19887684 | STK10 | 6793 | 0.08 | trans | ||
| rs1041786 | chr21 | 22617710 | STK10 | 6793 | 6.71E-4 | trans | ||
| rs5955025 | chrX | 142542997 | STK10 | 6793 | 0.15 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| PNMA3 | 0.86 | 0.84 |
| AL591845.1 | 0.83 | 0.78 |
| AC135048.1 | 0.81 | 0.75 |
| KCNT1 | 0.80 | 0.82 |
| PIGZ | 0.78 | 0.85 |
| SGK493 | 0.77 | 0.75 |
| DENND3 | 0.76 | 0.76 |
| ATG9A | 0.75 | 0.71 |
| AC011676.2 | 0.75 | 0.70 |
| TRPV6 | 0.75 | 0.74 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| SNRPG | -0.42 | -0.53 |
| TPT1 | -0.42 | -0.43 |
| GNG11 | -0.41 | -0.40 |
| RPL35 | -0.41 | -0.50 |
| AF347015.21 | -0.41 | -0.26 |
| C9orf46 | -0.40 | -0.41 |
| RPS20 | -0.40 | -0.51 |
| MYL12A | -0.40 | -0.42 |
| RPL24 | -0.39 | -0.41 |
| IL32 | -0.38 | -0.33 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0004674 | protein serine/threonine kinase activity | TAS | 9278426 | |
| GO:0016740 | transferase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006468 | protein amino acid phosphorylation | TAS | 9278426 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| ZHONG RESPONSE TO AZACITIDINE AND TSA UP | 183 | 119 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN NPM1 MUTATED SIGNATURE 2 DN | 77 | 46 | All SZGR 2.0 genes in this pathway |
| TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC DN | 187 | 115 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC1 AND HDAC2 TARGETS UP | 238 | 144 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
| CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS DN | 142 | 95 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION DN | 234 | 147 | All SZGR 2.0 genes in this pathway |
| EBAUER TARGETS OF PAX3 FOXO1 FUSION UP | 207 | 128 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| AMUNDSON RESPONSE TO ARSENITE | 217 | 143 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| SANSOM APC TARGETS DN | 366 | 238 | All SZGR 2.0 genes in this pathway |
| XU RESPONSE TO TRETINOIN AND NSC682994 UP | 17 | 13 | All SZGR 2.0 genes in this pathway |
| WANG TARGETS OF MLL CBP FUSION UP | 44 | 26 | All SZGR 2.0 genes in this pathway |
| NEMETH INFLAMMATORY RESPONSE LPS UP | 88 | 64 | All SZGR 2.0 genes in this pathway |
| BASSO CD40 SIGNALING UP | 101 | 76 | All SZGR 2.0 genes in this pathway |
| HANSON HRAS SIGNALING VIA NFKB | 22 | 14 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
| ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| ZHENG FOXP3 TARGETS IN T LYMPHOCYTE DN | 37 | 29 | All SZGR 2.0 genes in this pathway |
| FINETTI BREAST CANCER KINOME GREEN | 16 | 14 | All SZGR 2.0 genes in this pathway |
| RIZKI TUMOR INVASIVENESS 2D UP | 69 | 46 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER LUMINAL B DN | 564 | 326 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
| QI PLASMACYTOMA UP | 259 | 185 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
| MARSON FOXP3 TARGETS UP | 66 | 43 | All SZGR 2.0 genes in this pathway |
| WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
| SENGUPTA EBNA1 ANTICORRELATED | 173 | 85 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE EARLY LATE | 317 | 190 | All SZGR 2.0 genes in this pathway |
| FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
| KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
| KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
| PHONG TNF RESPONSE NOT VIA P38 | 337 | 236 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-485-5p | 2524 | 2530 | 1A | hsa-miR-485-5p | AGAGGCUGGCCGUGAUGAAUUC |
| miR-496 | 2770 | 2776 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.