SZGR2

Summary ?

GeneID	6908
Symbol	TBP
Synonyms	GTF2D\|GTF2D1\|HDL4\|SCA17\|TFIID
Description	TATA-box binding protein
Reference	MIM:600075\|HGNC:HGNC:11588\|Ensembl:ENSG00000112592\|HPRD:02511\|Vega:OTTHUMG00000016084
Gene type	protein-coding
Map location	6q27
Pascal p-value	0.215
Sherlock p-value	0.118
Fetal beta	1.038
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	1	Link to SZGene
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg11786005	6	170863399	TBP	2.24E-9	-0.007	1.73E-6	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs9570060	chr13	59754134	TBP	6908		0.15		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
GJA4	0.70	0.69
ESAM	0.68	0.69
FCGRT	0.66	0.68
BGN	0.65	0.69
TIMP1	0.64	0.67
MFSD2	0.61	0.64
TM4SF1	0.61	0.60
S100A11	0.61	0.62
TGFB1	0.59	0.62
ORAI3	0.59	0.62

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ZMAT2	-0.40	-0.46
CEP63	-0.39	-0.39
C1orf96	-0.38	-0.35
CIR1	-0.36	-0.39
LMO7	-0.36	-0.36
ZRSR2	-0.36	-0.37
GPR22	-0.35	-0.38
KHDRBS3	-0.35	-0.34
PITPNB	-0.35	-0.38
RNPC3	-0.35	-0.38

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003677	DNA binding	IEA		-
GO:0003702	RNA polymerase II transcription factor activity	IEA		-
GO:0005488	binding	IEA		-
GO:0005515	protein binding	IPI		1465435 \|7680771 \|8006019 \|9045704 \|9748258 \|10391676 \|12040021 \|12217962
GO:0016251	general RNA polymerase II transcription factor activity	TAS		2363050
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006367	transcription initiation from RNA polymerase II promoter	EXP		8946909
GO:0006367	transcription initiation from RNA polymerase II promoter	IEA		-
GO:0006367	transcription initiation from RNA polymerase II promoter	TAS		2363050
GO:0006368	RNA elongation from RNA polymerase II promoter	EXP		9405375
GO:0006350	transcription	IEA		-
GO:0008219	cell death	IEA		-
GO:0044419	interspecies interaction between organisms	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005654	nucleoplasm	EXP		1939271 \|2449431 \|8946909
GO:0005669	transcription factor TFIID complex	IDA		14580349
GO:0005669	transcription factor TFIID complex	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ABT1	hABT1	activator of basal transcription 1	-	HPRD	10648625
AHR	-	aryl hydrocarbon receptor	AHR interacts with TBP.	BIND	15641800
AHR	-	aryl hydrocarbon receptor	-	HPRD,BioGRID	8794892
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	Reconstituted Complex	BioGRID	9238003
ATF4	CREB-2 \| CREB2 \| TAXREB67 \| TXREB	activating transcription factor 4 (tax-responsive enhancer element B67)	Reconstituted Complex	BioGRID	9295363
BAX	BCL2L4	BCL2-associated X protein	TBP interacts with the Bax promoter.	BIND	15710329
BCL3	BCL4 \| D19S37	B-cell CLL/lymphoma 3	-	HPRD,BioGRID	9812988
BRF1	BRF \| FLJ42674 \| FLJ43034 \| GTF3B \| MGC105048 \| TAF3B2 \| TAF3C \| TAFIII90 \| TF3B90 \| TFIIIB90 \| hBRF	BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)	-	HPRD,BioGRID	7624363 \|10921893
BRF2	BRFU \| FLJ11052 \| TFIIIB50	BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1-like	-	HPRD,BioGRID	11564744
BTAF1	KIAA0940 \| MGC138406 \| MOT1 \| TAF(II)170 \| TAF172 \| TAFII170	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae)	-	HPRD,BioGRID	9488487
CBX5	HP1 \| HP1A	chromobox homolog 5 (HP1 alpha homolog, Drosophila)	Affinity Capture-Western	BioGRID	11959914
CD3EAP	ASE-1 \| CAST \| MGC118851 \| PAF49	CD3e molecule, epsilon associated protein	Affinity Capture-Western	BioGRID	15226435
CITED2	MRG1 \| P35SRJ	Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2	Reconstituted Complex	BioGRID	10593900
CREG1	CREG	cellular repressor of E1A-stimulated genes 1	-	HPRD,BioGRID	9710587
CREM	ICER \| MGC111110 \| MGC17881 \| MGC41893 \| hCREM-2	cAMP responsive element modulator	-	HPRD,BioGRID	10409662
CTBP1	BARS \| MGC104684	C-terminal binding protein 1	Reconstituted Complex	BioGRID	11959865
DHX9	DDX9 \| LKP \| NDHII \| RHA	DEAH (Asp-Glu-Ala-His) box polypeptide 9	-	HPRD,BioGRID	11149922
DR1	NC2 \| NC2-BETA	down-regulator of transcription 1, TBP-binding (negative cofactor 2)	-	HPRD	11461703
DRAP1	NC2-alpha	DR1-associated protein 1 (negative cofactor 2 alpha)	-	HPRD,BioGRID	11461703
EDF1	EDF-1 \| MBF1 \| MGC9058	endothelial differentiation-related factor 1	-	HPRD,BioGRID	10816571
EP300	KAT3B \| p300	E1A binding protein p300	p300 interacts with TBP.	BIND	8621548
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	-	HPRD,BioGRID	11595744
FOS	AP-1 \| C-FOS	v-fos FBJ murine osteosarcoma viral oncogene homolog	Affinity Capture-Western Reconstituted Complex	BioGRID	8065335
FOS	AP-1 \| C-FOS	v-fos FBJ murine osteosarcoma viral oncogene homolog	-	HPRD	7685215
FOXF2	FKHL6 \| FREAC2	forkhead box F2	-	HPRD,BioGRID	9722567
GLI2	HPE9 \| THP1 \| THP2	GLI-Kruppel family member GLI2	TBP interacts with GLI-2. This interaction was modeled on a demonstrated interaction between TBP from an unspecified species and human GLI-2.	BIND	11160734
GTF2A1	MGC129969 \| MGC129970 \| TF2A1 \| TFIIA	general transcription factor IIA, 1, 19/37kDa	Biochemical Activity Reconstituted Complex	BioGRID	7724559 \|7958900 \|9603936 \|11278496 \|11509574
GTF2A1L	ALF \| MGC26254	general transcription factor IIA, 1-like	Reconstituted Complex	BioGRID	12107178
GTF2A2	HsT18745 \| TF2A2 \| TFIIA	general transcription factor IIA, 2, 12kDa	-	HPRD,BioGRID	7724559 \|7958900 \|9603936
GTF2B	TF2B \| TFIIB	general transcription factor IIB	-	HPRD,BioGRID	14963322
GTF2E1	FE \| TF2E1 \| TFIIE-A	general transcription factor IIE, polypeptide 1, alpha 56kDa	-	HPRD	11113176
GTF2E1	FE \| TF2E1 \| TFIIE-A	general transcription factor IIE, polypeptide 1, alpha 56kDa	Co-purification Reconstituted Complex	BioGRID	7926747 \|9159119
GTF2E2	FE \| TF2E2 \| TFIIE-B	general transcription factor IIE, polypeptide 2, beta 34kDa	-	HPRD,BioGRID	9677423 \|11113176
GTF2F1	BTF4 \| RAP74 \| TF2F1 \| TFIIF	general transcription factor IIF, polypeptide 1, 74kDa	Biochemical Activity Co-purification Reconstituted Complex	BioGRID	7590250 \|9159119 \|9482861
GTF2F2	BTF4 \| RAP30 \| TF2F2 \| TFIIF	general transcription factor IIF, polypeptide 2, 30kDa	-	HPRD,BioGRID	8577725
GTF2H4	TFB2 \| TFIIH	general transcription factor IIH, polypeptide 4, 52kDa	Co-purification Reconstituted Complex	BioGRID	9159119
GTF3C2	KIAA0011 \| TFIIIC-BETA \| TFIIIC110	general transcription factor IIIC, polypeptide 2, beta 110kDa	Reconstituted Complex	BioGRID	10373544
GTF3C3	TFIIIC102 \| TFIIICgamma \| TFiiiC2-102	general transcription factor IIIC, polypeptide 3, 102kDa	-	HPRD,BioGRID	10373544
GTF3C4	FLJ21002 \| KAT12 \| MGC138450 \| TFIII90 \| TFIIIC90 \| TFIIICdelta \| TFiiiC2-90	general transcription factor IIIC, polypeptide 4, 90kDa	Reconstituted Complex	BioGRID	10373544
GTF3C5	FLJ20857 \| TFIIIC63 \| TFIIICepsilon \| TFiiiC2-63	general transcription factor IIIC, polypeptide 5, 63kDa	Reconstituted Complex	BioGRID	10373544
HMGB1	DKFZp686A04236 \| HMG1 \| HMG3 \| SBP-1	high-mobility group box 1	-	HPRD,BioGRID	9880542
HSF1	HSTF1	heat shock transcription factor 1	-	HPRD,BioGRID	11005381
HTT	HD \| IT15	huntingtin	Htt interacts with TBP.	BIND	15225551
HTT	HD \| IT15	huntingtin	-	HPRD	10410676
IKZF1	Hs.54452 \| IK1 \| IKAROS \| LYF1 \| PRO0758 \| ZNFN1A1 \| hIk-1	IKAROS family zinc finger 1 (Ikaros)	-	HPRD,BioGRID	11959865
IRF1	IRF-1 \| MAR	interferon regulatory factor 1	TBP interacts with IRF-1 promoter.	BIND	15893730
JARID1A	KDM5A \| RBBP2 \| RBP2	jumonji, AT rich interactive domain 1A	-	HPRD,BioGRID	7935440
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	-	HPRD,BioGRID	7848298
JUND	AP-1	jun D proto-oncogene	-	HPRD	7848298
KLF5	BTEB2 \| CKLF \| IKLF	Kruppel-like factor 5 (intestinal)	Reconstituted Complex	BioGRID	9089417
MCM2	BM28 \| CCNL1 \| CDCL1 \| D3S3194 \| KIAA0030 \| MGC10606 \| MITOTIN \| cdc19	minichromosome maintenance complex component 2	-	HPRD,BioGRID	12392551
MDM2	HDMX \| MGC71221 \| hdm2	Mdm2 p53 binding protein homolog (mouse)	Reconstituted Complex	BioGRID	9271120 \|9388200
MSX1	HOX7 \| HYD1	msh homeobox 1	Affinity Capture-Western in vivo Phenotypic Suppression Reconstituted Complex	BioGRID	8700832 \|9111364 \|10215616
MSX1	HOX7 \| HYD1	msh homeobox 1	-	HPRD	8700832 \|10215616
MYC	bHLHe39 \| c-Myc	v-myc myelocytomatosis viral oncogene homolog (avian)	Reconstituted Complex	BioGRID	8755740
MYC	bHLHe39 \| c-Myc	v-myc myelocytomatosis viral oncogene homolog (avian)	TBP interacts with c-Myc.	BIND	15723054
NACA	HSD48 \| MGC117224 \| NACA1	nascent polypeptide-associated complex alpha subunit	-	HPRD,BioGRID	8835540
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	-	HPRD,BioGRID	8754792
NCOA3	ACTR \| AIB-1 \| AIB1 \| CAGH16 \| CTG26 \| KAT13B \| MGC141848 \| RAC3 \| SRC3 \| TNRC14 \| TNRC16 \| TRAM-1 \| pCIP	nuclear receptor coactivator 3	-	HPRD	9267036
NCOA6	AIB3 \| ANTP \| ASC2 \| HOX1.1 \| HOXA7 \| KIAA0181 \| NRC \| PRIP \| RAP250 \| TRBP	nuclear receptor coactivator 6	Reconstituted Complex	BioGRID	10567404
NFYB	CBF-A \| CBF-B \| HAP3 \| NF-YB	nuclear transcription factor Y, beta	-	HPRD,BioGRID	9153318
NFYC	CBF-C \| CBFC \| DKFZp667G242 \| FLJ45775 \| H1TF2A \| HAP5 \| HSM \| NF-YC	nuclear transcription factor Y, gamma	Reconstituted Complex	BioGRID	9153318
NR3C1	GCCR \| GCR \| GR \| GRL	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	-	HPRD,BioGRID	9649342
PAX3	CDHS \| HUP2 \| MGC120381 \| MGC120382 \| MGC120383 \| MGC120384 \| MGC134778 \| WS1	paired box 3	Reconstituted Complex	BioGRID	10359315
PAX6	AN \| AN2 \| D11S812E \| MGC17209 \| MGDA \| WAGR	paired box 6	-	HPRD,BioGRID	10359315
POLR2A	MGC75453 \| POLR2 \| POLRA \| RPB1 \| RPBh1 \| RPO2 \| RPOL2 \| RpIILS \| hRPB220 \| hsRPB1	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	Co-purification Reconstituted Complex	BioGRID	9159119
POLR3C	RPC3 \| RPC62	polymerase (RNA) III (DNA directed) polypeptide C (62kD)	Affinity Capture-Western	BioGRID	9171375
POLR3F	MGC13517 \| RPC39 \| RPC6	polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa	-	HPRD,BioGRID	9171375
POU2F1	OCT1 \| OTF1	POU class 2 homeobox 1	-	HPRD,BioGRID	8202368
POU2F2	OCT2 \| OTF2 \| Oct-2	POU class 2 homeobox 2	-	HPRD,BioGRID	8202368
POU3F2	BRN2 \| OCT7 \| OTF7 \| POUF3	POU class 3 homeobox 2	Brn-2 interacts with TBP.	BIND	11029584
PSMC2	MGC3004 \| MSS1 \| Nbla10058 \| S7	proteasome (prosome, macropain) 26S subunit, ATPase, 2	-	HPRD,BioGRID	11118327
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	Rb interacts with TBP	BIND	11094070
REL	C-Rel	v-rel reticuloendotheliosis viral oncogene homolog (avian)	-	HPRD,BioGRID	8413269
RELA	MGC131774 \| NFKB3 \| p65	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	-	HPRD,BioGRID	7706261 \|9584164
RIBIN	-	rRNA promoter binding protein	TBP interacts with rDNA.	BIND	15723054
RNF4	RES4-26 \| SNURF	ring finger protein 4	Reconstituted Complex	BioGRID	9710597
RRN3	DKFZp566E104 \| MGC104238 \| TIFIA	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	Affinity Capture-Western	BioGRID	11250903
RUVBL1	ECP54 \| INO80H \| NMP238 \| PONTIN \| Pontin52 \| RVB1 \| TIH1 \| TIP49 \| TIP49A	RuvB-like 1 (E. coli)	Reconstituted Complex	BioGRID	9843967
RXRA	FLJ00280 \| FLJ00318 \| FLJ16020 \| FLJ16733 \| MGC102720 \| NR2B1	retinoid X receptor, alpha	-	HPRD,BioGRID	7667283
SNAPC2	PTFdelta \| SNAP45	small nuclear RNA activating complex, polypeptide 2, 45kDa	-	HPRD,BioGRID	8633057
SNAPC4	FLJ13451 \| PTFalpha \| SNAP190	small nuclear RNA activating complex, polypeptide 4, 190kDa	-	HPRD,BioGRID	12621023
SNURF	-	SNRPN upstream reading frame	Phenotypic Enhancement	BioGRID	11696545
SPIB	SPI-B	Spi-B transcription factor (Spi-1/PU.1 related)	-	HPRD,BioGRID	10196196
SUB1	MGC102747 \| P15 \| PC4 \| p14	SUB1 homolog (S. cerevisiae)	-	HPRD	9482861
TAF1	BA2R \| CCG1 \| CCGS \| DYT3 \| KAT4 \| N-TAF1 \| NSCL2 \| OF \| P250 \| TAF2A \| TAFII250	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	-	HPRD,BioGRID	7680771
TAF10	TAF2A \| TAF2H \| TAFII30	TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa	-	HPRD	7923369
TAF10	TAF2A \| TAF2H \| TAFII30	TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa	Co-purification	BioGRID	7680771 \|9153318
TAF11	MGC:15243 \| PRO2134 \| TAF2I \| TAFII28	TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa	-	HPRD,BioGRID	7729427
TAF13	MGC22425 \| TAF2K \| TAFII18	TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa	-	HPRD,BioGRID	7729427
TAF15	Npl3 \| RBP56 \| TAF2N \| TAFII68 \| hTAFII68	TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa	Affinity Capture-Western Reconstituted Complex	BioGRID	8663456
TAF1A	MGC:17061 \| RAFI48 \| SL1 \| TAFI48	TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa	-	HPRD,BioGRID	7801123
TAF1A	MGC:17061 \| RAFI48 \| SL1 \| TAFI48	TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa	TBP interacts with TAFI48 within the SL1 transcription factor complex	BIND	7801123
TAF1B	MGC:9349 \| RAF1B \| RAFI63 \| SL1 \| TAFI63	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	-	HPRD,BioGRID	7801123
TAF1B	MGC:9349 \| RAF1B \| RAFI63 \| SL1 \| TAFI63	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	TBP interacts with TAFI63 within the SL1 transcription factor complex.	BIND	7801123
TAF1C	MGC:39976 \| SL1 \| TAFI110 \| TAFI95	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	-	HPRD,BioGRID	7801123
TAF1C	MGC:39976 \| SL1 \| TAFI110 \| TAFI95	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	TBP interacts with TAFI110 within the SL1 transcription factor complex	BIND	7801123
TAF1L	MGC134910 \| TAF2A2	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	-	HPRD,BioGRID	12217962
TAF2	CIF150 \| TAF2B \| TAFII150	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	TBP interacts with TAFII150. This interaction was modelled on a demonstrated interaction between human TBP and TAFII150 from Drosophila.	BIND	7801123
TAF2	CIF150 \| TAF2B \| TAFII150	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	Co-purification	BioGRID	7680771
TAF4	FLJ41943 \| TAF2C \| TAF2C1 \| TAF4A \| TAFII130 \| TAFII135	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	Affinity Capture-Western Co-purification	BioGRID	9153318 \|12665565
TAF5	TAF2D \| TAFII100	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	-	HPRD,BioGRID	9045704
TAF6	DKFZp781E21155 \| MGC:8964 \| TAF2E \| TAFII70 \| TAFII80 \| TAFII85	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	Affinity Capture-Western Co-purification	BioGRID	7680771 \|9153318 \|12665565
TAF7	TAF2F \| TAFII55	TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa	Affinity Capture-Western Co-purification	BioGRID	9153318 \|12665565
TAF7L	FLJ23157 \| TAF2Q \| dJ738A13.1	TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa	-	HPRD,BioGRID	12665565
TAF9	AD-004 \| AK6 \| CGI-137 \| CINAP \| CIP \| MGC1603 \| MGC3647 \| MGC5067 \| MGC:1603 \| MGC:3647 \| MGC:5067 \| TAF2G \| TAFII31 \| TAFII32 \| TAFIID32	TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa	Co-purification	BioGRID	9153318
TBP	GTF2D \| GTF2D1 \| MGC117320 \| MGC126054 \| MGC126055 \| SCA17 \| TFIID	TATA box binding protein	Affinity Capture-Western	BioGRID	8650542
TCEA1	GTF2S \| SII \| TCEA \| TF2S \| TFIIS	transcription elongation factor A (SII), 1	Reconstituted Complex	BioGRID	9305922
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	-	HPRD,BioGRID	1465435
TRAM2	KIAA0057	translocation associated membrane protein 2	-	HPRD	14612417
TRIP4	HsT17391	thyroid hormone receptor interactor 4	-	HPRD	10454579
UBTF	NOR-90 \| UBF	upstream binding transcription factor, RNA polymerase I	-	HPRD,BioGRID	8552083
WDR62	C19orf14 \| DKFZp434J046 \| DKFZp686G1024 \| FLJ33298 \| MGC166976	WD repeat domain 62	Two-hybrid	BioGRID	16169070

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG BASAL TRANSCRIPTION FACTORS	36	24	All SZGR 2.0 genes in this pathway
KEGG HUNTINGTONS DISEASE	185	109	All SZGR 2.0 genes in this pathway
BIOCARTA CARM ER PATHWAY	35	27	All SZGR 2.0 genes in this pathway
BIOCARTA RARRXR PATHWAY	15	9	All SZGR 2.0 genes in this pathway
PID REG GR PATHWAY	82	60	All SZGR 2.0 genes in this pathway
PID MYC REPRESS PATHWAY	63	52	All SZGR 2.0 genes in this pathway
PID RB 1PATHWAY	65	46	All SZGR 2.0 genes in this pathway
REACTOME RNA POL III TRANSCRIPTION INITIATION FROM TYPE 2 PROMOTER	23	12	All SZGR 2.0 genes in this pathway
REACTOME RNA POL II TRANSCRIPTION	105	54	All SZGR 2.0 genes in this pathway
REACTOME RNA POL III TRANSCRIPTION	33	18	All SZGR 2.0 genes in this pathway
REACTOME RNA POL II TRANSCRIPTION PRE INITIATION AND PROMOTER OPENING	41	21	All SZGR 2.0 genes in this pathway
REACTOME TRANSCRIPTION	210	127	All SZGR 2.0 genes in this pathway
REACTOME RNA POL I RNA POL III AND MITOCHONDRIAL TRANSCRIPTION	122	80	All SZGR 2.0 genes in this pathway
REACTOME RNA POL II PRE TRANSCRIPTION EVENTS	61	32	All SZGR 2.0 genes in this pathway
REACTOME RNA POL III TRANSCRIPTION INITIATION FROM TYPE 3 PROMOTER	26	13	All SZGR 2.0 genes in this pathway
REACTOME HIV INFECTION	207	122	All SZGR 2.0 genes in this pathway
REACTOME HIV LIFE CYCLE	125	69	All SZGR 2.0 genes in this pathway
REACTOME LATE PHASE OF HIV LIFE CYCLE	104	61	All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER DN	406	230	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS UP	293	179	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN	1024	594	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS	734	436	All SZGR 2.0 genes in this pathway
SAKAI TUMOR INFILTRATING MONOCYTES DN	81	51	All SZGR 2.0 genes in this pathway
HOFMANN CELL LYMPHOMA UP	50	35	All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS UP	268	157	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
SETLUR PROSTATE CANCER TMPRSS2 ERG FUSION UP	67	48	All SZGR 2.0 genes in this pathway
MARTENS BOUND BY PML RARA FUSION	456	287	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway
BAKKER FOXO3 TARGETS DN	187	109	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	474	481	1A,m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-15/16/195/424/497	229	236	1A,m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-200bc/429	488	494	m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-379	394	400	1A	hsa-miR-379^brain	UGGUAGACUAUGGAACGUA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: TBP