SZGR2

Summary ?

GeneID	7041
Symbol	TGFB1I1
Synonyms	ARA55\|HIC-5\|HIC5\|TSC-5
Description	transforming growth factor beta 1 induced transcript 1
Reference	MIM:602353\|HGNC:HGNC:11767\|Ensembl:ENSG00000140682\|HPRD:03831\|Vega:OTTHUMG00000132467
Gene type	protein-coding
Map location	16p11.2
Pascal p-value	0.242
Fetal beta	0.138
DMG	1 (# studies)
eGene	Cerebellar Hemisphere Cerebellum

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.01775

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg25395329	16	31487852	TGFB1I1	6.73E-7	0.361	0.007	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
M6PR	0.85	0.83
WDR42A	0.83	0.79
FECH	0.80	0.77
HDHD2	0.79	0.75
SNX9	0.79	0.78
RAB5B	0.79	0.74
AARS	0.79	0.75
COG1	0.78	0.77
FAM82A2	0.78	0.75
APLP2	0.78	0.74

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
IL32	-0.53	-0.37
AF347015.21	-0.53	-0.25
FAM159B	-0.52	-0.53
GNG11	-0.48	-0.34
CLEC3B	-0.47	-0.47
AL050337.1	-0.46	-0.30
AF347015.18	-0.44	-0.17
C1orf54	-0.44	-0.28
APOC1	-0.43	-0.25
AC098691.2	-0.43	-0.31

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003713	transcription coactivator activity	IDA		10075738
GO:0003713	transcription coactivator activity	NAS		15572661
GO:0005515	protein binding	IPI		17353931
GO:0008270	zinc ion binding	IEA		-
GO:0046872	metal ion binding	IEA		-
GO:0050681	androgen receptor binding	IPI		10075738
GO:0050681	androgen receptor binding	NAS		15572661
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007155	cell adhesion	TAS		9422762
GO:0006366	transcription from RNA polymerase II promoter	TAS		10075738
GO:0016055	Wnt receptor signaling pathway	IEA		-
GO:0008285	negative regulation of cell proliferation	TAS		7929412
GO:0030154	cell differentiation	IEA		-
GO:0030521	androgen receptor signaling pathway	NAS		15572661
GO:0045893	positive regulation of transcription, DNA-dependent	NAS		15572661
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005856	cytoskeleton	IEA		-
GO:0005622	intracellular	IDA		10075738
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0016363	nuclear matrix	IEA		-
GO:0030054	cell junction	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	-	HPRD	11155740
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	The carboxy terminus of ARA55 interacts with the carboxy terminus AR to enhance transcriptional activity.	BIND	10075738
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	Affinity Capture-Western Protein-peptide Reconstituted Complex Two-hybrid	BioGRID	11779876 \|11856738
CCNA1	-	cyclin A1	Affinity Capture-MS	BioGRID	17353931
CRKL	-	v-crk sarcoma virus CT10 oncogene homolog (avian)-like	-	HPRD	9858471 \|11463817
CSK	MGC117393	c-src tyrosine kinase	Reconstituted Complex	BioGRID	9858471
FKBP1A	FKBP-12 \| FKBP1 \| FKBP12 \| FKBP12C \| PKC12 \| PKCI2 \| PPIASE	FK506 binding protein 1A, 12kDa	-	HPRD	12417722
GIT1	-	G protein-coupled receptor kinase interacting ArfGAP 1	-	HPRD	12153727
HSPB1	CMT2F \| DKFZp586P1322 \| HMN2B \| HS.76067 \| HSP27 \| HSP28 \| Hsp25 \| SRP27	heat shock 27kDa protein 1	Two-hybrid	BioGRID	11546764
ITGA4	CD49D \| IA4 \| MGC90518	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	TGFB1I1 (Hic-5) interacts with integrin alpha-4 (ITGA4).	BIND	10604475
NR3C1	GCCR \| GCR \| GR \| GRL	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	-	HPRD,BioGRID	10848625
PTK2	FADK \| FAK \| FAK1 \| pp125FAK	PTK2 protein tyrosine kinase 2	-	HPRD	9422762 \|9756887
PTK2	FADK \| FAK \| FAK1 \| pp125FAK	PTK2 protein tyrosine kinase 2	Affinity Capture-Western Reconstituted Complex	BioGRID	9422762 \|9858471 \|11463817
PTK2B	CADTK \| CAKB \| FADK2 \| FAK2 \| FRNK \| PKB \| PTK \| PYK2 \| RAFTK	PTK2B protein tyrosine kinase 2 beta	-	HPRD	9422762 \|11856738
PTK2B	CADTK \| CAKB \| FADK2 \| FAK2 \| FRNK \| PKB \| PTK \| PYK2 \| RAFTK	PTK2B protein tyrosine kinase 2 beta	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	9422762 \|9858471 \|11856738
PTPN12	PTP-PEST \| PTPG1	protein tyrosine phosphatase, non-receptor type 12	-	HPRD,BioGRID	10092676
PXN	FLJ16691	paxillin	Affinity Capture-Western	BioGRID	11463817
SDC4	MGC22217 \| SYND4	syndecan 4	-	HPRD	11805099
SLC6A3	DAT \| DAT1	solute carrier family 6 (neurotransmitter transporter, dopamine), member 3	-	HPRD,BioGRID	12177201
SMAD3	DKFZp586N0721 \| DKFZp686J10186 \| HSPC193 \| HsT17436 \| JV15-2 \| MADH3 \| MGC60396	SMAD family member 3	ARA55 interacts with Smad3. This interaction was modeled on a demonstrated interaction between human ARA55 and Smad3 from an unspecified species.	BIND	15561701
SMAD4	DPC4 \| JIP \| MADH4	SMAD family member 4	ARA55 interacts with Smad4. This interaction was modeled on a demonstrated interaction between human ARA55 and Smad4 from an unspecified species.	BIND	15561701
SVIL	DKFZp686A17191	supervillin	-	HPRD	11792840
TGFBR2	AAT3 \| FAA3 \| LDS1B \| LDS2B \| MFS2 \| RIIC \| TAAD2 \| TGFR-2 \| TGFbeta-RII	transforming growth factor, beta receptor II (70/80kDa)	-	HPRD	12421567
TRAF4	CART1 \| MLN62 \| RNF83	TNF receptor-associated factor 4	TRAF4 interacts with Hic-5.	BIND	12023963
VCL	CMD1W \| MVCL	vinculin	Reconstituted Complex	BioGRID	9858471
VHL	HRCA1 \| RCA1 \| VHL1	von Hippel-Lindau tumor suppressor	Affinity Capture-MS	BioGRID	17353931

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID AR PATHWAY	61	46	All SZGR 2.0 genes in this pathway
LIU PROSTATE CANCER DN	481	290	All SZGR 2.0 genes in this pathway
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN	169	118	All SZGR 2.0 genes in this pathway
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP	351	230	All SZGR 2.0 genes in this pathway
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 UP	146	86	All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP	255	177	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN	460	312	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 DN	242	165	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 DN	281	186	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC UP	185	126	All SZGR 2.0 genes in this pathway
LOPEZ MESOTHELIOMA SURVIVAL WORST VS BEST UP	14	10	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN	536	332	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 8HR UP	164	122	All SZGR 2.0 genes in this pathway
GRAHAM CML QUIESCENT VS NORMAL QUIESCENT DN	47	32	All SZGR 2.0 genes in this pathway
GRAHAM CML DIVIDING VS NORMAL QUIESCENT DN	95	57	All SZGR 2.0 genes in this pathway
GRAHAM NORMAL QUIESCENT VS NORMAL DIVIDING UP	66	47	All SZGR 2.0 genes in this pathway
SASAI RESISTANCE TO NEOPLASTIC TRANSFROMATION	50	31	All SZGR 2.0 genes in this pathway
HATADA METHYLATED IN LUNG CANCER UP	390	236	All SZGR 2.0 genes in this pathway
TOMLINS PROSTATE CANCER DN	40	33	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN	1024	594	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
FRIDMAN SENESCENCE UP	77	60	All SZGR 2.0 genes in this pathway
FRIDMAN IMMORTALIZATION DN	34	24	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN	428	306	All SZGR 2.0 genes in this pathway
AMIT SERUM RESPONSE 240 MCF10A	57	36	All SZGR 2.0 genes in this pathway
VERHAAK AML WITH NPM1 MUTATED DN	246	180	All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA DN	408	274	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP	249	170	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR DN	178	121	All SZGR 2.0 genes in this pathway
LEE AGING MUSCLE UP	45	33	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
MARSON BOUND BY E2F4 UNSTIMULATED	728	415	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING	510	309	All SZGR 2.0 genes in this pathway
NAKAMURA METASTASIS MODEL DN	43	28	All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS DN	210	128	All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK	1210	725	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SURVIVAL UP	73	49	All SZGR 2.0 genes in this pathway
LOPEZ MESOTHELIOMA SURVIVAL OVERALL DN	16	8	All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3	718	401	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 17	181	101	All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE DN	841	431	All SZGR 2.0 genes in this pathway
FIGUEROA AML METHYLATION CLUSTER 7 UP	118	68	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B	549	316	All SZGR 2.0 genes in this pathway
PASINI SUZ12 TARGETS DN	315	215	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway
KIM TIAL1 TARGETS	32	22	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
ALFANO MYC TARGETS	239	156	All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN	308	187	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY	1725	838	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-199	102	108	1A	hsa-miR-199a	CCCAGUGUUCAGACUACCUGUUC
miR-199	102	108	1A	hsa-miR-199b	CCCAGUGUUUAGACUAUCUGUUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: TGFB1I1