SZGR2

Summary ?

GeneID	7068
Symbol	THRB
Synonyms	C-ERBA-2\|C-ERBA-BETA\|ERBA2\|GRTH\|NR1A2\|PRTH\|THR1\|THRB1\|THRB2
Description	thyroid hormone receptor beta
Reference	MIM:190160\|HGNC:HGNC:11799\|Ensembl:ENSG00000151090\|HPRD:07521\|Vega:OTTHUMG00000130478
Gene type	protein-coding
Map location	3p24.2
Pascal p-value	1.81E-5
Fetal beta	-1.834
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
GSMA_I	Genome scan meta-analysis	Psr: 0.006
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0385

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg19763108	3	24187579	THRB	7.93E-5	0.596	0.025	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SATB2	0.83	0.81
NKAIN2	0.82	0.76
TDRD7	0.80	0.79
LPL	0.79	0.58
LGALS8	0.79	0.77
SLC44A5	0.79	0.66
CCBE1	0.79	0.62
ADAMTSL3	0.78	0.75
CHST15	0.77	0.79
RBM24	0.77	0.78

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
HSD17B14	-0.56	-0.61
MT-CO2	-0.53	-0.53
AF347015.31	-0.52	-0.51
BDH2	-0.51	-0.55
MT-CYB	-0.51	-0.50
AF347015.8	-0.51	-0.51
AIFM3	-0.51	-0.50
C11orf67	-0.51	-0.54
AF347015.27	-0.50	-0.49
AF347015.2	-0.50	-0.51

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004887	thyroid hormone receptor activity	TAS		1618799
GO:0003700	transcription factor activity	NAS		1618799
GO:0003707	steroid hormone receptor activity	IEA		-
GO:0003714	transcription corepressor activity	TAS		1618799
GO:0005515	protein binding	IPI		7870181 \|15100213 \|15625236
GO:0008270	zinc ion binding	IEA		-
GO:0046872	metal ion binding	IEA		-
GO:0043565	sequence-specific DNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0009887	organ morphogenesis	IEA		-
GO:0008016	regulation of heart contraction	IEA		-
GO:0007605	sensory perception of sound	IEA		-
GO:0016481	negative regulation of transcription	IEA		-
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	TAS		1618799

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ANP32A	C15orf1 \| I1PP2A \| LANP \| MAPM \| MGC119787 \| MGC150373 \| PHAP1 \| PHAPI \| PP32	acidic (leucine-rich) nuclear phosphoprotein 32 family, member A	TR-beta interacts with pp32.	BIND	15308690
BRD8	SMAP \| SMAP2 \| p120	bromodomain containing 8	Reconstituted Complex Two-hybrid	BioGRID	9368056
BTG1	-	B-cell translocation gene 1, anti-proliferative	BTG1 interacts with THRB (TR-beta-1). This interaction was modeled on a demonstrated interaction between human BTG1 and TR-beta-1 from an unspecified species.	BIND	15674337
CCND1	BCL1 \| D11S287E \| PRAD1 \| U21B31	cyclin D1	Affinity Capture-Western Reconstituted Complex	BioGRID	12048199
COPS2	ALIEN \| CSN2 \| SGN2 \| TRIP15	COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)	-	HPRD,BioGRID	7776974 \|10207062
CTCF	-	CCCTC-binding factor (zinc finger protein)	TR interacts with CTCF.	BIND	10625678
EIF3I	EIF3S2 \| PRO2242 \| TRIP-1 \| TRIP1 \| eIF3-beta \| eIF3-p36	eukaryotic translation initiation factor 3, subunit I	Two-hybrid	BioGRID	9368056
HDAC3	HD3 \| RPD3 \| RPD3-2	histone deacetylase 3	-	HPRD	10944117
JMJD1C	DKFZp761F0118 \| FLJ14374 \| KIAA1380 \| RP11-10C13.2 \| TRIP8	jumonji domain containing 1C	-	HPRD	7776974
MECR	CGI-63 \| FASN2B \| NRBF1	mitochondrial trans-2-enoyl-CoA reductase	-	HPRD	9795230
MED1	CRSP1 \| CRSP200 \| DRIP205 \| DRIP230 \| MGC71488 \| PBP \| PPARBP \| PPARGBP \| RB18A \| TRAP220 \| TRIP2	mediator complex subunit 1	-	HPRD	9325263
MED21	SRB7 \| SURB7	mediator complex subunit 21	TR-beta interacts with hSrb7.	BIND	15249124
MPG	AAG \| APNG \| CRA36.1 \| MDG \| Mid1 \| PIG11 \| PIG16 \| anpg	N-methylpurine-DNA glycosylase	MPG interacts with THRB (TR-beta). This interaction was modeled on a demonstrated interaction between MPG from an unspecified species and THRB from an unspecified species.	BIND	14761960
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	-	HPRD,BioGRID	9171239
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	SRC-1 interacts with THR-beta. This interaction was modelled on a demonstrated interaction between human SRC-1 and rat TR-beta.	BIND	9346901
NCOA2	GRIP1 \| KAT13C \| MGC138808 \| NCoA-2 \| TIF2	nuclear receptor coactivator 2	-	HPRD,BioGRID	11518802
NCOA2	GRIP1 \| KAT13C \| MGC138808 \| NCoA-2 \| TIF2	nuclear receptor coactivator 2	GRIP1 interacts with TR. This interaction was modeled on a demonstrated interaction between mouse GRIP1 and human TR.	BIND	10454563
NCOA3	ACTR \| AIB-1 \| AIB1 \| CAGH16 \| CTG26 \| KAT13B \| MGC141848 \| RAC3 \| SRC3 \| TNRC14 \| TNRC16 \| TRAM-1 \| pCIP	nuclear receptor coactivator 3	TRAM-1 interacts with TR-beta. This interaction was modelled on a demonstrated interaction between human TRAM-1 and rat TR-beta.	BIND	9346901
NCOA3	ACTR \| AIB-1 \| AIB1 \| CAGH16 \| CTG26 \| KAT13B \| MGC141848 \| RAC3 \| SRC3 \| TNRC14 \| TNRC16 \| TRAM-1 \| pCIP	nuclear receptor coactivator 3	ACTR interacts with TR.	BIND	9267036
NCOA6	AIB3 \| ANTP \| ASC2 \| HOX1.1 \| HOXA7 \| KIAA0181 \| NRC \| PRIP \| RAP250 \| TRBP	nuclear receptor coactivator 6	Reconstituted Complex Two-hybrid	BioGRID	10567404 \|10823961 \|11158331 \|11773444
NCOR2	CTG26 \| SMRT \| SMRTE \| SMRTE-tau \| TNRC14 \| TRAC-1 \| TRAC1	nuclear receptor co-repressor 2	Reconstituted Complex	BioGRID	9751500
NR2F6	EAR-2 \| EAR2 \| ERBAL2	nuclear receptor subfamily 2, group F, member 6	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	10713182
NRBF2	COPR1 \| COPR2 \| DKFZp564C1664 \| FLJ30395 \| NRBF-2	nuclear receptor binding factor 2	-	HPRD,BioGRID	10786636
PPARGC1A	LEM6 \| PGC-1(alpha) \| PGC-1v \| PGC1 \| PGC1A \| PPARGC1	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	-	HPRD,BioGRID	11751919
PPARGC1B	ERRL1 \| PERC \| PGC-1(beta) \| PGC1B	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	Reconstituted Complex	BioGRID	11733490
PRMT1	ANM1 \| HCP1 \| HRMT1L2 \| IR1B4	protein arginine methyltransferase 1	Reconstituted Complex	BioGRID	11050077
PRMT2	HRMT1L1 \| MGC111373	protein arginine methyltransferase 2	PRMT2 interacts with TR-beta.	BIND	12039952
PSMC3IP	GT198 \| HOP2 \| HUMGT198A \| TBPIP	PSMC3 interacting protein	-	HPRD	11739747
PSMC5	S8 \| SUG1 \| TBP10 \| TRIP1 \| p45 \| p45/SUG	proteasome (prosome, macropain) 26S subunit, ATPase, 5	Two-hybrid	BioGRID	7870181
RXRA	FLJ00280 \| FLJ00318 \| FLJ16020 \| FLJ16733 \| MGC102720 \| NR2B1	retinoid X receptor, alpha	Reconstituted Complex	BioGRID	9368056
RXRB	DAUDI6 \| H-2RIIBP \| MGC1831 \| NR2B2 \| RCoR-1	retinoid X receptor, beta	THR-beta interacts with RXR-beta. This interaction was modelled on a demonstrated interaction between rat TR-beta and mouse RXR-beta.	BIND	9346901
RXRG	NR2B3 \| RXRC	retinoid X receptor, gamma	-	HPRD	9794455
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	Reconstituted Complex	BioGRID	10454579
TBL1X	EBI \| SMAP55 \| TBL1	transducin (beta)-like 1X-linked	Reconstituted Complex	BioGRID	10809664
THRB	ERBA-BETA \| ERBA2 \| GRTH \| MGC126109 \| MGC126110 \| NR1A2 \| PRTH \| THR1 \| THRB1 \| THRB2	thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)	Reconstituted Complex	BioGRID	9751500
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	-	HPRD,BioGRID	11258898
TRIP12	KIAA0045 \| MGC138849 \| MGC138850	thyroid hormone receptor interactor 12	-	HPRD	7776974
TRIP4	HsT17391	thyroid hormone receptor interactor 4	-	HPRD,BioGRID	7776974 \|10454579
TSG101	TSG10 \| VPS23	tumor susceptibility gene 101	Two-hybrid	BioGRID	10508170

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION	272	195	All SZGR 2.0 genes in this pathway
BIOCARTA EGFR SMRTE PATHWAY	11	11	All SZGR 2.0 genes in this pathway
PID RXR VDR PATHWAY	26	24	All SZGR 2.0 genes in this pathway
REACTOME GENERIC TRANSCRIPTION PATHWAY	352	181	All SZGR 2.0 genes in this pathway
REACTOME NUCLEAR RECEPTOR TRANSCRIPTION PATHWAY	49	36	All SZGR 2.0 genes in this pathway
LIU SOX4 TARGETS UP	137	94	All SZGR 2.0 genes in this pathway
TURASHVILI BREAST LOBULAR CARCINOMA VS LOBULAR NORMAL UP	94	59	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS DN	260	143	All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA DN	291	176	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD DN	150	93	All SZGR 2.0 genes in this pathway
CHANG IMMORTALIZED BY HPV31 DN	65	45	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX DN	88	58	All SZGR 2.0 genes in this pathway
LOPES METHYLATED IN COLON CANCER DN	28	26	All SZGR 2.0 genes in this pathway
CHENG IMPRINTED BY ESTRADIOL	110	68	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER LATE RECURRENCE DN	69	48	All SZGR 2.0 genes in this pathway
FIGUEROA AML METHYLATION CLUSTER 7 UP	118	68	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 UP	344	215	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN	448	282	All SZGR 2.0 genes in this pathway
KRIEG KDM3A TARGETS NOT HYPOXIA	208	107	All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP	289	184	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	764	770	1A	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-1/206	51	57	1A	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-101	3770	3776	m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-124.1	1472	1478	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124.1	1472	1478	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	1472	1478	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	1472	1478	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-128	3772	3778	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	3772	3778	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-135	1501	1508	1A,m8	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
miR-135	1501	1508	1A,m8	hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-138	280	286	m8	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-138	280	286	m8	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-141/200a	4447	4454	1A,m8	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	4447	4454	1A,m8	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-146	4321	4327	m8	hsa-miR-146a	UGAGAACUGAAUUCCAUGGGUU
miR-146	4321	4327	m8	hsa-miR-146b^brain	UGAGAACUGAAUUCCAUAGGCU
miR-181	1410	1417	1A,m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-21	4632	4638	m8	hsa-miR-21^brain	UAGCUUAUCAGACUGAUGUUGA
miR-21	4632	4638	m8	hsa-miR-590	GAGCUUAUUCAUAAAAGUGCAG
miR-218	4167	4173	1A	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-219	4108	4115	1A,m8	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-27	3772	3778	m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	3772	3778	m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-329	3813	3820	1A,m8	hsa-miR-329^brain	AACACACCUGGUUAACCUCUUU
miR-34b	1470	1476	m8	hsa-miR-34b	UAGGCAGUGUCAUUAGCUGAUUG
miR-381	4543	4549	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-431	4105	4111	1A	hsa-miR-431	UGUCUUGCAGGCCGUCAUGCA
miR-452	4441	4448	1A,m8	hsa-miR-452	UGUUUGCAGAGGAAACUGAGAC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: THRB