SZGR2

Summary ?

GeneID	7917
Symbol	BAG6
Synonyms	BAG-6\|BAT3\|D6S52E\|G3
Description	BCL2 associated athanogene 6
Reference	MIM:142590\|HGNC:HGNC:13919\|Ensembl:ENSG00000204463\|HPRD:00808\|Vega:OTTHUMG00000031171
Gene type	protein-coding
Map location	6p21.3
Pascal p-value	1E-12
Sherlock p-value	1
eGene	Caudate basal ganglia Cerebellar Hemisphere Cerebellum Cortex Frontal Cortex BA9 Myers' cis & trans Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs16836102	chr4	4716366	BAG6	7917		0.07		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		14667819 \|15231747 \|17353931
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006464	protein modification process	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ARPC3	ARC21 \| p21-Arc	actin related protein 2/3 complex, subunit 3, 21kDa	Two-hybrid	BioGRID	16169070
B2M	-	beta-2-microglobulin	Two-hybrid	BioGRID	16169070
C19orf10	EUROIMAGE1875335 \| IL25 \| IL27 \| IL27w \| R33729_1 \| SF20	chromosome 19 open reading frame 10	Two-hybrid	BioGRID	16169070
CDK4	CMM3 \| MGC14458 \| PSK-J3	cyclin-dependent kinase 4	Two-hybrid	BioGRID	16169070
CHN2	ARHGAP3 \| BCH \| MGC138360 \| RHOGAP3	chimerin (chimaerin) 2	Two-hybrid	BioGRID	16169070
CSTF2	CstF-64	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa	Two-hybrid	BioGRID	16169070
CTSB	APPS \| CPSB	cathepsin B	Two-hybrid	BioGRID	16169070
CTSE	CATE	cathepsin E	Two-hybrid	BioGRID	16169070
DNAJB11	ABBP-2 \| ABBP2 \| DJ9 \| EDJ \| ERdj3 \| ERj3 \| HEDJ \| PRO1080 \| UNQ537 \| hDj9	DnaJ (Hsp40) homolog, subfamily B, member 11	Two-hybrid	BioGRID	16169070
DPT	TRAMP	dermatopontin	Two-hybrid	BioGRID	16169070
EDN1	ET1 \| HDLCQ7	endothelin 1	Two-hybrid	BioGRID	16169070
EFEMP2	FBLN4 \| MBP1 \| UPH1	EGF-containing fibulin-like extracellular matrix protein 2	Two-hybrid	BioGRID	16189514
FAM173A	C16orf24 \| MGC2494	family with sequence similarity 173, member A	Two-hybrid	BioGRID	16169070
FKBP2	FKBP-13 \| PPIase	FK506 binding protein 2, 13kDa	Two-hybrid	BioGRID	16169070
HSPA1A	FLJ54303 \| FLJ54370 \| FLJ54392 \| FLJ54408 \| FLJ75127 \| HSP70-1 \| HSP70-1A \| HSP70I \| HSP72 \| HSPA1 \| HSPA1B	heat shock 70kDa protein 1A	in vivo	BioGRID	11230127
IER3	DIF-2 \| DIF2 \| GLY96 \| IEX-1 \| IEX-1L \| IEX1 \| PRG1	immediate early response 3	An unspecified isoform of IEX-1 interacts with BAT3.	BIND	15451437
IGFBP5	IBP5	insulin-like growth factor binding protein 5	Two-hybrid	BioGRID	16169070
IKBKAP	DKFZp781H1425 \| DYS \| ELP1 \| FD \| FLJ12497 \| IKAP \| IKI3 \| TOT1	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	Two-hybrid	BioGRID	16169070
IMMT	DKFZp779P1653 \| HMP \| MGC111146 \| P87 \| P87/89 \| P89 \| PIG4 \| PIG52	inner membrane protein, mitochondrial (mitofilin)	Two-hybrid	BioGRID	16169070
IQCG	DKFZp434B227 \| FLJ11667 \| FLJ23571 \| FLJ37775	IQ motif containing G	Two-hybrid	BioGRID	16169070
KLHL12	C3IP1 \| DKIR \| FLJ27152	kelch-like 12 (Drosophila)	Two-hybrid	BioGRID	16189514
MAGED1	DLXIN-1 \| NRAGE	melanoma antigen family D, 1	Affinity Capture-MS	BioGRID	17353931
NBL1	D1S1733E \| DAN \| DAND1 \| MGC8972 \| NB \| NO3	neuroblastoma, suppression of tumorigenicity 1	-	HPRD,BioGRID	10390159
NDUFA6	B14 \| CI-B14 \| LYRM6 \| NADHB14	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa	Two-hybrid	BioGRID	16169070
NOMO1	Nomo \| PM5	NODAL modulator 1	Two-hybrid	BioGRID	16169070
PELP1	HMX3 \| MNAR \| P160	proline, glutamate and leucine rich protein 1	Two-hybrid	BioGRID	16169070
PPAP2C	LPP2 \| PAP-2c \| PAP2-g	phosphatidic acid phosphatase type 2C	Two-hybrid	BioGRID	16169070
PPP4C	PP4 \| PPH3 \| PPX	protein phosphatase 4 (formerly X), catalytic subunit	Affinity Capture-MS	BioGRID	17353931
PRG2	LPPR3 \| LPR3 \| PRG-2	plasticity-related gene 2	Two-hybrid	BioGRID	16169070
PRNP	ASCR \| CD230 \| CJD \| GSS \| MGC26679 \| PRIP \| PrP \| PrP27-30 \| PrP33-35C \| PrPc \| prion	prion protein	Two-hybrid	BioGRID	16169070
PTH	PTH1	parathyroid hormone	Two-hybrid	BioGRID	16169070
RAB8A	MEL \| RAB8	RAB8A, member RAS oncogene family	Two-hybrid	BioGRID	16169070
RCN2	E6BP \| ERC-55 \| ERC55 \| TCBP49	reticulocalbin 2, EF-hand calcium binding domain	Two-hybrid	BioGRID	16169070
REG1B	PSPS2 \| REGH \| REGI-BETA \| REGL	regenerating islet-derived 1 beta	Two-hybrid	BioGRID	16169070
RNF126	FLJ20552 \| MGC1022 \| MGC14317	ring finger protein 126	-	HPRD	14667819
S100A4	18A2 \| 42A \| CAPL \| FSP1 \| MTS1 \| P9KA \| PEL98	S100 calcium binding protein A4	Two-hybrid	BioGRID	16169070
SETDB1	ESET \| KG1T \| KIAA0067 \| KMT1E	SET domain, bifurcated 1	Two-hybrid	BioGRID	16169070
SMN1	BCD541 \| SMA \| SMA1 \| SMA2 \| SMA3 \| SMA4 \| SMA@ \| SMN \| SMNT \| T-BCD541	survival of motor neuron 1, telomeric	Two-hybrid	BioGRID	16169070
STX5	SED5 \| STX5A	syntaxin 5	Two-hybrid	BioGRID	16169070
TAC1	Hs.2563 \| NK2 \| NKNA \| NPK \| TAC2	tachykinin, precursor 1	Two-hybrid	BioGRID	16169070
TDGF1	CR \| CRGF \| CRIPTO \| Cripto-1	teratocarcinoma-derived growth factor 1	Two-hybrid	BioGRID	16169070
TOMM20	KIAA0016 \| MAS20 \| MGC117367 \| MOM19 \| TOM20	translocase of outer mitochondrial membrane 20 homolog (yeast)	Two-hybrid	BioGRID	16169070
TSC22D1	DKFZp686O19206 \| MGC17597 \| RP11-269C23.2 \| TGFB1I4 \| TSC22	TSC22 domain family, member 1	Affinity Capture-MS	BioGRID	17353931
UBL7	BMSC-UbP \| MGC14421 \| TCBA1	ubiquitin-like 7 (bone marrow stromal cell-derived)	-	HPRD	14667819
WDR8	FLJ20430 \| MGC99569	WD repeat domain 8	Affinity Capture-MS	BioGRID	17353931
XRN1	DKFZp434P0721 \| DKFZp686B22225 \| DKFZp686F19113 \| FLJ41903 \| SEP1	5'-3' exoribonuclease 1	-	HPRD,BioGRID	15231747

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
LIU SOX4 TARGETS DN	309	191	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN	180	101	All SZGR 2.0 genes in this pathway
DARWICHE SKIN TUMOR PROMOTER DN	185	115	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW DN	165	107	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH DN	180	110	All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA DN	181	107	All SZGR 2.0 genes in this pathway
IVANOV MUTATED IN COLON CANCER	13	9	All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 6	84	54	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN	514	319	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
MCCLUNG DELTA FOSB TARGETS 8WK	47	38	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX UP	83	66	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 7	51	34	All SZGR 2.0 genes in this pathway
MARSON BOUND BY E2F4 UNSTIMULATED	728	415	All SZGR 2.0 genes in this pathway
MATZUK SPERMATOCYTE	72	55	All SZGR 2.0 genes in this pathway
MUELLER PLURINET	299	189	All SZGR 2.0 genes in this pathway
MOOTHA PGC	420	269	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
FONTAINE FOLLICULAR THYROID ADENOMA UP	75	43	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP	756	494	All SZGR 2.0 genes in this pathway
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP	682	440	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-200bc/429	60	66	m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-331	31	37	1A	hsa-miR-331^brain	GCCCCUGGGCCUAUCCUAGAA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: BAG6