Gene Page: VTCN1
Summary ?
GeneID | 79679 |
Symbol | VTCN1 |
Synonyms | B7-H4|B7H4|B7S1|B7X|B7h.5|PRO1291|VCTN1 |
Description | V-set domain containing T cell activation inhibitor 1 |
Reference | MIM:608162|HGNC:HGNC:28873|Ensembl:ENSG00000134258|HPRD:06429|Vega:OTTHUMG00000012118 |
Gene type | protein-coding |
Map location | 1p13.1 |
Pascal p-value | 0.028 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0006955 | immune response | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
SENGUPTA NASOPHARYNGEAL CARCINOMA DN | 349 | 157 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST DUCTAL CARCINOMA VS DUCTAL NORMAL DN | 198 | 110 | All SZGR 2.0 genes in this pathway |
DOANE RESPONSE TO ANDROGEN DN | 241 | 146 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
RICKMAN HEAD AND NECK CANCER E | 89 | 44 | All SZGR 2.0 genes in this pathway |
LIN SILENCED BY TUMOR MICROENVIRONMENT | 108 | 73 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY NO BLOOD UP | 222 | 139 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
POOLA INVASIVE BREAST CANCER DN | 134 | 83 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 LCP WITH H3K4ME3 | 162 | 80 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP | 289 | 184 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL DN | 428 | 246 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-125/351 | 304 | 311 | 1A,m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
miR-15/16/195/424/497 | 486 | 492 | 1A | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-503 | 485 | 492 | 1A,m8 | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.