Gene Page: SYN3
Summary ?
| GeneID | 8224 |
| Symbol | SYN3 |
| Synonyms | - |
| Description | synapsin III |
| Reference | MIM:602705|HGNC:HGNC:11496|Ensembl:ENSG00000185666|HPRD:04083|Vega:OTTHUMG00000031004 |
| Gene type | protein-coding |
| Map location | 22q12.3 |
| Pascal p-value | 0.044 |
| Support | CANABINOID DOPAMINE EXOCYTOSIS SEROTONIN G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
| GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 4 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| TFAP2C | 0.86 | 0.50 |
| DMRTA2 | 0.84 | 0.49 |
| GPC4 | 0.84 | 0.52 |
| LRIG3 | 0.84 | 0.29 |
| COL4A6 | 0.80 | 0.68 |
| NHLH1 | 0.80 | 0.49 |
| SOX3 | 0.75 | 0.58 |
| CELSR1 | 0.75 | 0.60 |
| JUB | 0.74 | 0.44 |
| ITGA2 | 0.73 | 0.28 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| LGI4 | -0.23 | -0.32 |
| SLC16A11 | -0.21 | -0.55 |
| SLC9A3R2 | -0.21 | -0.49 |
| FBXO2 | -0.21 | -0.65 |
| C5orf53 | -0.21 | -0.64 |
| ADAP1 | -0.21 | -0.41 |
| ASPHD1 | -0.21 | -0.57 |
| TMEM54 | -0.20 | -0.49 |
| TNFSF12 | -0.20 | -0.59 |
| LHPP | -0.20 | -0.57 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0003824 | catalytic activity | IEA | - | |
| GO:0005509 | calcium ion binding | IEA | - | |
| GO:0005524 | ATP binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007269 | neurotransmitter secretion | IEA | neuron, axon, Synap, serotonin, Neurotransmitter, dopamine (GO term level: 8) | - |
| GO:0007269 | neurotransmitter secretion | TAS | neuron, axon, Synap, serotonin, Neurotransmitter, dopamine (GO term level: 8) | 9539796 |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0008021 | synaptic vesicle | IEA | Synap, Neurotransmitter (GO term level: 12) | - |
| GO:0008021 | synaptic vesicle | TAS | Synap, Neurotransmitter (GO term level: 12) | 9539796 |
| GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
| GO:0016020 | membrane | IEA | - | |
| GO:0030054 | cell junction | IEA | - | |
| GO:0031410 | cytoplasmic vesicle | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME TRANSMISSION ACROSS CHEMICAL SYNAPSES | 186 | 155 | All SZGR 2.0 genes in this pathway |
| REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
| REACTOME NEUROTRANSMITTER RELEASE CYCLE | 34 | 30 | All SZGR 2.0 genes in this pathway |
| REACTOME DOPAMINE NEUROTRANSMITTER RELEASE CYCLE | 11 | 11 | All SZGR 2.0 genes in this pathway |
| LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
| MANTOVANI NFKB TARGETS UP | 43 | 33 | All SZGR 2.0 genes in this pathway |
| MANTOVANI VIRAL GPCR SIGNALING UP | 86 | 54 | All SZGR 2.0 genes in this pathway |
| SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 | 419 | 273 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC ICP WITH H3K4ME3 | 445 | 257 | All SZGR 2.0 genes in this pathway |
| ZWANG EGF PERSISTENTLY DN | 61 | 36 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-452 | 462 | 469 | 1A,m8 | hsa-miR-452 | UGUUUGCAGAGGAAACUGAGAC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.