Gene Page: PLCD4
Summary ?
| GeneID | 84812 |
| Symbol | PLCD4 |
| Synonyms | - |
| Description | phospholipase C delta 4 |
| Reference | MIM:605939|HGNC:HGNC:9062|Ensembl:ENSG00000115556|HPRD:07296|Vega:OTTHUMG00000154743 |
| Gene type | protein-coding |
| Map location | 2q35 |
| Sherlock p-value | 1.549E-5 |
| Fetal beta | -0.508 |
| eGene | Cerebellar Hemisphere Cerebellum |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:McCarthy_2014 | Whole Exome Sequencing analysis | Whole exome sequencing of 57 trios with sporadic or familial schizophrenia. | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01016 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00916 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| PLCD4 | chr2 | 219498436 | A | G | NM_032726 | p.I520V | missense SNV | Schizophrenia | DNM:McCarthy_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004871 | signal transducer activity | IEA | - | |
| GO:0005509 | calcium ion binding | IEA | - | |
| GO:0004435 | phosphoinositide phospholipase C activity | IEA | - | |
| GO:0016787 | hydrolase activity | IEA | - | |
| GO:0008081 | phosphoric diester hydrolase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016042 | lipid catabolic process | IEA | - | |
| GO:0007242 | intracellular signaling cascade | IEA | - | |
| GO:0006629 | lipid metabolic process | IEA | - | |
| GO:0007340 | acrosome reaction | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0005783 | endoplasmic reticulum | IEA | - | |
| GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG INOSITOL PHOSPHATE METABOLISM | 54 | 42 | All SZGR 2.0 genes in this pathway |
| KEGG CALCIUM SIGNALING PATHWAY | 178 | 134 | All SZGR 2.0 genes in this pathway |
| KEGG PHOSPHATIDYLINOSITOL SIGNALING SYSTEM | 76 | 56 | All SZGR 2.0 genes in this pathway |
| APPIERTO RESPONSE TO FENRETINIDE UP | 38 | 26 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS FETAL LIVER UP | 227 | 137 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
| HILLION HMGA1 TARGETS | 90 | 71 | All SZGR 2.0 genes in this pathway |
| AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 2G | 171 | 96 | All SZGR 2.0 genes in this pathway |
| MATZUK SPERMATOZOA | 114 | 77 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF LCP WITH H3K27ME3 | 70 | 35 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC LCP WITH H3K4ME3 | 58 | 34 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-199 | 547 | 553 | 1A | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
| hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.