Gene Page: DIXDC1
Summary ?
| GeneID | 85458 |
| Symbol | DIXDC1 |
| Synonyms | CCD1 |
| Description | DIX domain containing 1 |
| Reference | MIM:610493|HGNC:HGNC:23695|Ensembl:ENSG00000150764|HPRD:16804|Vega:OTTHUMG00000166912 |
| Gene type | protein-coding |
| Map location | 11q23.1 |
| Pascal p-value | 0.985 |
| Sherlock p-value | 0.664 |
| Fetal beta | 1.398 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.006 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| snp_a-1916780 | 0 | DIXDC1 | 85458 | 0.09 | trans | |||
| rs6812244 | chr4 | 140705509 | DIXDC1 | 85458 | 0.18 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003779 | actin binding | IEA | - | |
| GO:0004871 | signal transducer activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016055 | Wnt receptor signaling pathway | IEA | - | |
| GO:0007275 | multicellular organismal development | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| WNT SIGNALING | 89 | 71 | All SZGR 2.0 genes in this pathway |
| SOTIRIOU BREAST CANCER GRADE 1 VS 3 DN | 52 | 34 | All SZGR 2.0 genes in this pathway |
| DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
| GINESTIER BREAST CANCER 20Q13 AMPLIFICATION UP | 119 | 66 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR UP | 176 | 115 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
| CHEN LVAD SUPPORT OF FAILING HEART UP | 103 | 69 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
| MCCABE BOUND BY HOXC6 | 469 | 239 | All SZGR 2.0 genes in this pathway |
| VART KSHV INFECTION ANGIOGENIC MARKERS DN | 138 | 92 | All SZGR 2.0 genes in this pathway |
| MCMURRAY TP53 HRAS COOPERATION RESPONSE DN | 67 | 46 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
| QI HYPOXIA | 140 | 96 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| GOBERT CORE OLIGODENDROCYTE DIFFERENTIATION | 40 | 28 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
| PLASARI TGFB1 TARGETS 10HR DN | 244 | 157 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 276 | 282 | 1A | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-141/200a | 239 | 245 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
| hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
| miR-15/16/195/424/497 | 321 | 327 | 1A | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
| hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
| hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
| hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
| hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
| hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
| miR-182 | 106 | 112 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-34/449 | 1277 | 1284 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
| hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
| hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
| hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
| miR-378 | 56 | 62 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
| miR-452 | 475 | 481 | m8 | hsa-miR-452 | UGUUUGCAGAGGAAACUGAGAC |
| hsa-miR-452 | UGUUUGCAGAGGAAACUGAGAC | ||||
| miR-503 | 321 | 327 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
| miR-9 | 504 | 511 | 1A,m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
| miR-96 | 105 | 112 | 1A,m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.