SZGR2

Summary ?

GeneID	8763
Symbol	CD164
Synonyms	DFNA66\|MGC-24\|MUC-24\|endolyn
Description	CD164 molecule
Reference	MIM:603356\|HGNC:HGNC:1632\|Ensembl:ENSG00000135535\|HPRD:04523\|Vega:OTTHUMG00000015339
Gene type	protein-coding
Map location	6q21
Pascal p-value	0.281
Sherlock p-value	0.687
Fetal beta	-0.805
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	3

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg14703058	6	109703831	CD164	4.64E-13	-0.01	1.43E-7	DMG:Jaffe_2016
cg00615550	6	109703901	CD164	5.49E-9	-0.021	3.02E-6	DMG:Jaffe_2016
cg00041901	6	109703809	CD164	7.53E-8	-0.008	1.79E-5	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs17107208	chr1	52884681	CD164	8763		0.07		trans
rs17139868	chr7	117079228	CD164	8763		0.13		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
COL6A3	0.65	0.55
ISLR	0.63	0.59
ITIH2	0.62	0.45
IGF2	0.60	0.49
TBX18	0.59	0.51
COL3A1	0.59	0.23
CYP1B1	0.59	0.59
OSR1	0.59	0.50
XPNPEP2	0.58	0.31
COL1A1	0.57	0.35

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.23	-0.19
AL139819.3	-0.21	-0.21
MT-CO2	-0.21	-0.16
RP9P	-0.21	-0.38
AF347015.31	-0.21	-0.15
AF347015.8	-0.20	-0.15
ZBTB8OS	-0.20	-0.22
MT-CYB	-0.20	-0.14
UQCRB	-0.20	-0.20
MT-ATP8	-0.20	-0.13

Section III. Gene Ontology annotation

Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007162	negative regulation of cell adhesion	NAS		10878358
GO:0007155	cell adhesion	IDA		10491205
GO:0007157	heterophilic cell adhesion	IDA		10491205
GO:0007165	signal transduction	TAS		9763543
GO:0008285	negative regulation of cell proliferation	NAS		10878358
GO:0008285	negative regulation of cell proliferation	TAS		9763543
GO:0006955	immune response	TAS		9763543
GO:0007275	multicellular organismal development	TAS		9680353
GO:0030097	hemopoiesis	NAS		11027692
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	IEA		-
GO:0005634	nucleus	IDA		18029348
GO:0005737	cytoplasm	IDA		18029348
GO:0005768	endosome	NAS		11027692
GO:0005886	plasma membrane	IDA		10491205
GO:0005887	integral to plasma membrane	NAS		11027692
GO:0005887	integral to plasma membrane	TAS		9763543

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG LYSOSOME	121	83	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 UP	137	84	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
KIM MYCN AMPLIFICATION TARGETS DN	103	59	All SZGR 2.0 genes in this pathway
TSAI RESPONSE TO IONIZING RADIATION	149	101	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN	584	395	All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS	775	494	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
DER IFN ALPHA RESPONSE UP	74	48	All SZGR 2.0 genes in this pathway
DER IFN BETA RESPONSE UP	102	67	All SZGR 2.0 genes in this pathway
ROSS AML OF FAB M7 TYPE	68	44	All SZGR 2.0 genes in this pathway
CROMER METASTASIS UP	79	46	All SZGR 2.0 genes in this pathway
YAGI AML FAB MARKERS	191	131	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
TAKAO RESPONSE TO UVB RADIATION DN	98	67	All SZGR 2.0 genes in this pathway
JIANG HYPOXIA NORMAL	311	205	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3	720	440	All SZGR 2.0 genes in this pathway
KONDO EZH2 TARGETS	245	148	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE UP	578	341	All SZGR 2.0 genes in this pathway
SARRIO EPITHELIAL MESENCHYMAL TRANSITION UP	180	114	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER ERBB2 UP	147	83	All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING	510	309	All SZGR 2.0 genes in this pathway
LABBE TARGETS OF TGFB1 AND WNT3A DN	108	68	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR UP	294	199	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER SURVIVAL DN	175	103	All SZGR 2.0 genes in this pathway
SPIRA SMOKERS LUNG CANCER UP	38	24	All SZGR 2.0 genes in this pathway
CHAUHAN RESPONSE TO METHOXYESTRADIOL DN	102	65	All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER DN	238	145	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN	442	275	All SZGR 2.0 genes in this pathway
HSIAO HOUSEKEEPING GENES	389	245	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP	605	377	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
MARTENS BOUND BY PML RARA FUSION	456	287	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A	898	516	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS DN	418	245	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	1707	1713	1A	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-124.1	652	658	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124.1	652	658	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	651	658	1A,m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
				hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-132/212	783	789	1A	hsa-miR-212^SZ	UAACAGUCUCCAGUCACGGCC
miR-132/212	783	789	1A	hsa-miR-132^brain	UAACAGUCUACAGCCAUGGUCG
miR-15/16/195/424/497	241	247	m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-19	1619	1625	1A	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	1619	1625	1A	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-219	1110	1117	1A,m8	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-24	2091	2097	1A	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG
miR-299-3p	79	85	m8	hsa-miR-299-3p	UAUGUGGGAUGGUAAACCGCUU
miR-324-5p	120	126	1A	hsa-miR-324-5p	CGCAUCCCCUAGGGCAUUGGUGU
miR-362	573	579	1A	hsa-miR-362	AAUCCUUGGAACCUAGGUGUGAGU
miR-421	1022	1028	1A	hsa-miR-421	GGCCUCAUUAAAUGUUUGUUG
miR-495	1608	1614	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-96	390	397	1A,m8	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CD164