SZGR2

Summary ?

GeneID	8848
Symbol	TSC22D1
Synonyms	Ptg-2\|TGFB1I4\|TSC22
Description	TSC22 domain family member 1
Reference	MIM:607715\|HGNC:HGNC:16826\|Ensembl:ENSG00000102804\|HPRD:07414\|Vega:OTTHUMG00000016838
Gene type	protein-coding
Map location	13q14
Pascal p-value	0.327
Sherlock p-value	0.354
Fetal beta	0.303
DMG	1 (# studies)
Support	CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0363

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg22183626	13	45150990	TSC22D1		-0.03	0.25	DMG:Nishioka_2013

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SCN8A	0.94	0.93
KCNB1	0.93	0.91
AP000751.3	0.92	0.92
MEF2D	0.92	0.92
DLGAP2	0.91	0.84
TLN2	0.91	0.93
AAK1	0.91	0.94
SORL1	0.91	0.84
KCNMA1	0.90	0.80
LRRC8B	0.90	0.86

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
DBI	-0.46	-0.62
RAB34	-0.45	-0.56
MYL12A	-0.44	-0.63
PECI	-0.42	-0.50
RAB13	-0.42	-0.53
RHOC	-0.42	-0.58
EFEMP2	-0.42	-0.44
C1orf61	-0.42	-0.61
C21orf57	-0.41	-0.41
C9orf46	-0.41	-0.38

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006350	transcription	IEA		-
GO:0006366	transcription from RNA polymerase II promoter	TAS		9022669
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
APLP1	APLP	amyloid beta (A4) precursor-like protein 1	Two-hybrid	BioGRID	16169070
ASAH1	AC \| ASAH \| FLJ21558 \| FLJ22079 \| PHP \| PHP32	N-acylsphingosine amidohydrolase (acid ceramidase) 1	Two-hybrid	BioGRID	16169070
BAT3	BAG-6 \| BAG6 \| D6S52E \| G3	HLA-B associated transcript 3	Affinity Capture-MS	BioGRID	17353931
CCDC90B	MDS011 \| MDS025 \| MGC104239	coiled-coil domain containing 90B	Two-hybrid	BioGRID	16169070
CDK2	p33(CDK2)	cyclin-dependent kinase 2	Affinity Capture-MS	BioGRID	17353931
COPB2	beta'-COP	coatomer protein complex, subunit beta 2 (beta prime)	Affinity Capture-MS	BioGRID	17353931
CORO2B	CLIPINC \| KIAA0925	coronin, actin binding protein, 2B	Two-hybrid	BioGRID	16169070
DYNC1H1	DHC1 \| DHC1a \| DKFZp686P2245 \| DNCH1 \| DNCL \| DNECL \| DYHC \| Dnchc1 \| HL-3 \| KIAA0325 \| p22	dynein, cytoplasmic 1, heavy chain 1	Affinity Capture-MS	BioGRID	17353931
EPPK1	EPIPL \| EPIPL1	epiplakin 1	Affinity Capture-MS	BioGRID	17353931
GCN1L1	GCN1 \| GCN1L \| KIAA0219	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	Affinity Capture-MS	BioGRID	17353931
GSTK1	GST13	glutathione S-transferase kappa 1	Affinity Capture-MS	BioGRID	17353931
HEATR2	FLJ20397 \| FLJ25564 \| FLJ31671 \| FLJ39381	HEAT repeat containing 2	Affinity Capture-MS	BioGRID	17353931
HNRNPM	DKFZp547H118 \| HNRNPM4 \| HNRPM \| HNRPM4 \| HTGR1 \| NAGR1	heterogeneous nuclear ribonucleoprotein M	Affinity Capture-MS	BioGRID	17353931
IARS	FLJ20736 \| IARS1 \| ILRS \| PRO0785	isoleucyl-tRNA synthetase	Affinity Capture-MS	BioGRID	17353931
KIAA0090	RP1-43E13.1	KIAA0090	Affinity Capture-MS	BioGRID	17353931
MAP3K12	DLK \| MUK \| ZPK \| ZPKP1	mitogen-activated protein kinase kinase kinase 12	Two-hybrid	BioGRID	16169070
MTR	FLJ33168 \| FLJ43216 \| FLJ45386 \| MS	5-methyltetrahydrofolate-homocysteine methyltransferase	Affinity Capture-MS	BioGRID	17353931
NDUFA9	MGC111043 \| NDUFS2L	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa	Affinity Capture-MS	BioGRID	17353931
NRBP1	BCON3 \| FLJ27109 \| FLJ35541 \| MADM \| MUDPNP \| NRBP	nuclear receptor binding protein 1	Affinity Capture-MS	BioGRID	17353931
NUP93	KIAA0095 \| MGC21106	nucleoporin 93kDa	Affinity Capture-MS	BioGRID	17353931
RGS1	1R20 \| BL34 \| IER1 \| IR20	regulator of G-protein signaling 1	Two-hybrid	BioGRID	16169070
RPA3	REPA3	replication protein A3, 14kDa	Affinity Capture-MS	BioGRID	17353931
SETDB1	ESET \| KG1T \| KIAA0067 \| KMT1E	SET domain, bifurcated 1	Two-hybrid	BioGRID	16169070
SFXN1	FLJ12876	sideroflexin 1	Affinity Capture-MS	BioGRID	17353931
SLC25A22	FLJ13044 \| GC1	solute carrier family 25 (mitochondrial carrier: glutamate), member 22	Affinity Capture-MS	BioGRID	17353931
SRPRB	APMCF1	signal recognition particle receptor, B subunit	Affinity Capture-MS	BioGRID	17353931
TSC22D1	DKFZp686O19206 \| MGC17597 \| RP11-269C23.2 \| TGFB1I4 \| TSC22	TSC22 domain family, member 1	Two-hybrid	BioGRID	16169070
TSC22D4	THG-1 \| THG1	TSC22 domain family, member 4	-	HPRD	10488076

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP	579	346	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
HORIUCHI WTAP TARGETS UP	306	188	All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP	372	227	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D UP	157	91	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC DN	187	115	All SZGR 2.0 genes in this pathway
DITTMER PTHLH TARGETS UP	112	68	All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS UP	456	228	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 6HR DN	167	100	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN	805	505	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES UP	19	15	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP	530	342	All SZGR 2.0 genes in this pathway
CHEBOTAEV GR TARGETS DN	120	73	All SZGR 2.0 genes in this pathway
MARKEY RB1 ACUTE LOF DN	228	137	All SZGR 2.0 genes in this pathway
LANDIS ERBB2 BREAST TUMORS 65 DN	37	22	All SZGR 2.0 genes in this pathway
LANDIS ERBB2 BREAST TUMORS 324 DN	149	93	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS UP	169	127	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION 12HR	43	35	All SZGR 2.0 genes in this pathway
TSUNODA CISPLATIN RESISTANCE DN	51	38	All SZGR 2.0 genes in this pathway
DAIRKEE TERT TARGETS UP	380	213	All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER UP	358	245	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS	290	172	All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS	734	436	All SZGR 2.0 genes in this pathway
BENPORATH NOS TARGETS	179	105	All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES	648	385	All SZGR 2.0 genes in this pathway
UEDA PERIFERAL CLOCK	169	111	All SZGR 2.0 genes in this pathway
NELSON RESPONSE TO ANDROGEN UP	86	61	All SZGR 2.0 genes in this pathway
JECHLINGER EPITHELIAL TO MESENCHYMAL TRANSITION DN	66	47	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN	546	351	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP	555	346	All SZGR 2.0 genes in this pathway
GALINDO IMMUNE RESPONSE TO ENTEROTOXIN	85	67	All SZGR 2.0 genes in this pathway
WANG IMMORTALIZED BY HOXA9 AND MEIS1 DN	24	15	All SZGR 2.0 genes in this pathway
FERRANDO T ALL WITH MLL ENL FUSION UP	87	67	All SZGR 2.0 genes in this pathway
LENAOUR DENDRITIC CELL MATURATION DN	128	90	All SZGR 2.0 genes in this pathway
WANG TARGETS OF MLL CBP FUSION DN	45	31	All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS UP	214	133	All SZGR 2.0 genes in this pathway
TAKAO RESPONSE TO UVB RADIATION UP	86	55	All SZGR 2.0 genes in this pathway
KAAB FAILED HEART ATRIUM DN	141	99	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX UP	83	66	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C6	39	27	All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS DN	57	39	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK UP	244	151	All SZGR 2.0 genes in this pathway
TSENG IRS1 TARGETS DN	135	88	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 1	33	24	All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G1	67	41	All SZGR 2.0 genes in this pathway
TSENG ADIPOGENIC POTENTIAL DN	46	28	All SZGR 2.0 genes in this pathway
KAAB FAILED HEART VENTRICLE DN	41	28	All SZGR 2.0 genes in this pathway
BILD HRAS ONCOGENIC SIGNATURE	261	166	All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE UP	393	244	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3	720	440	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP	602	364	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP	601	369	All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6	469	239	All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY DN	58	39	All SZGR 2.0 genes in this pathway
LABBE TGFB1 TARGETS UP	102	64	All SZGR 2.0 genes in this pathway
CHEN HOXA5 TARGETS 9HR UP	223	132	All SZGR 2.0 genes in this pathway
TSAI RESPONSE TO RADIATION THERAPY	32	20	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C DN	59	39	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO CSF2RB AND IL4 DN	315	201	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF UP	418	282	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP	408	276	All SZGR 2.0 genes in this pathway
CHANG CORE SERUM RESPONSE DN	209	137	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP	221	150	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR UP	293	203	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS UP	108	78	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP	395	249	All SZGR 2.0 genes in this pathway
CROONQUIST NRAS VS STROMAL STIMULATION DN	99	65	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES DN	210	141	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G24	28	19	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE M G1	148	95	All SZGR 2.0 genes in this pathway
RAGHAVACHARI PLATELET SPECIFIC GENES	70	46	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS SENESCENT	572	352	All SZGR 2.0 genes in this pathway
KIM GLIS2 TARGETS UP	84	61	All SZGR 2.0 genes in this pathway
BAKKER FOXO3 TARGETS DN	187	109	All SZGR 2.0 genes in this pathway
KASLER HDAC7 TARGETS 1 UP	194	133	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN	448	282	All SZGR 2.0 genes in this pathway
JUBAN TARGETS OF SPI1 AND FLI1 UP	115	73	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	530	536	m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-124/506	296	302	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	296	302	m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-134	81	87	m8	hsa-miR-134^brain	UGUGACUGGUUGACCAGAGGG
miR-200bc/429	147	154	1A,m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-203.1	89	95	1A	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-205	623	629	m8	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-381	642	648	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-542-3p	502	508	m8	hsa-miR-542-3p	UGUGACAGAUUGAUAACUGAAA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: TSC22D1