Gene Page: SEMA5A
Summary ?
GeneID | 9037 |
Symbol | SEMA5A |
Synonyms | SEMAF|semF |
Description | semaphorin 5A |
Reference | MIM:609297|HGNC:HGNC:10736|Ensembl:ENSG00000112902|HPRD:10219|Vega:OTTHUMG00000090501 |
Gene type | protein-coding |
Map location | 5p15.2 |
Pascal p-value | 0.289 |
Fetal beta | -0.614 |
DMG | 1 (# studies) |
eGene | Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg04555220 | 5 | 9546695 | SEMA5A | 4.824E-4 | -0.502 | 0.046 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0008046 | axon guidance receptor activity | IEA | axon (GO term level: 6) | - |
GO:0004872 | receptor activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007411 | axon guidance | IEA | axon (GO term level: 13) | - |
GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 9464278 |
GO:0001569 | patterning of blood vessels | IEA | - | |
GO:0007155 | cell adhesion | TAS | 9049630 | |
GO:0007267 | cell-cell signaling | TAS | 9464278 | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0030154 | cell differentiation | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0043231 | intracellular membrane-bounded organelle | IDA | 18029348 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME OTHER SEMAPHORIN INTERACTIONS | 15 | 14 | All SZGR 2.0 genes in this pathway |
REACTOME SEMAPHORIN INTERACTIONS | 68 | 53 | All SZGR 2.0 genes in this pathway |
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN | 169 | 118 | All SZGR 2.0 genes in this pathway |
WATANABE COLON CANCER MSI VS MSS DN | 81 | 42 | All SZGR 2.0 genes in this pathway |
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN | 391 | 222 | All SZGR 2.0 genes in this pathway |
DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 UP | 341 | 197 | All SZGR 2.0 genes in this pathway |
BIDUS METASTASIS DN | 161 | 93 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS UP | 149 | 84 | All SZGR 2.0 genes in this pathway |
HAHTOLA MYCOSIS FUNGOIDES SKIN UP | 177 | 113 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS CDC25 UP | 58 | 39 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
MOHANKUMAR TLX1 TARGETS DN | 193 | 112 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM5 | 94 | 59 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 UP | 256 | 159 | All SZGR 2.0 genes in this pathway |
SMITH LIVER CANCER | 45 | 27 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 16HR DN | 86 | 62 | All SZGR 2.0 genes in this pathway |
WESTON VEGFA TARGETS 6HR | 59 | 38 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 24HR DN | 148 | 102 | All SZGR 2.0 genes in this pathway |
WESTON VEGFA TARGETS | 108 | 71 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR DN | 178 | 121 | All SZGR 2.0 genes in this pathway |
XU GH1 AUTOCRINE TARGETS UP | 268 | 157 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
GENTILE UV LOW DOSE DN | 67 | 46 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
LABBE WNT3A TARGETS DN | 97 | 53 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB DN | 342 | 220 | All SZGR 2.0 genes in this pathway |
ALONSO METASTASIS UP | 198 | 128 | All SZGR 2.0 genes in this pathway |
RUIZ TNC TARGETS UP | 153 | 107 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN | 229 | 135 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS DN | 553 | 343 | All SZGR 2.0 genes in this pathway |
LE NEURONAL DIFFERENTIATION DN | 19 | 16 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
BOSCO ALLERGEN INDUCED TH2 ASSOCIATED MODULE | 151 | 86 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
NABA ECM AFFILIATED | 171 | 89 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 6062 | 6068 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-155 | 1076 | 1083 | 1A,m8 | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
miR-203.1 | 112 | 118 | 1A | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
hsa-miR-203 | UGAAAUGUUUAGGACCACUAG | ||||
miR-24 | 214 | 220 | 1A | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
miR-369-3p | 7774 | 7781 | 1A,m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-374 | 7775 | 7781 | m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
miR-378 | 6178 | 6184 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.