Gene Page: SYNGR1
Summary ?
GeneID | 9145 |
Symbol | SYNGR1 |
Synonyms | - |
Description | synaptogyrin 1 |
Reference | MIM:603925|HGNC:HGNC:11498|Ensembl:ENSG00000100321|HPRD:06800|Vega:OTTHUMG00000030978 |
Gene type | protein-coding |
Map location | 22q13.1 |
Sherlock p-value | 0.369 |
Fetal beta | -1.674 |
eGene | Myers' cis & trans |
Support | EXOCYTOSIS G2Cdb.human_mGluR5 G2Cdb.humanNRC CompositeSet Darnell FMRP targets Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 2 | Link to SZGene |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs6924957 | chr6 | 96853578 | SYNGR1 | 9145 | 0.15 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SMU1 | 0.93 | 0.92 |
SSR1 | 0.92 | 0.93 |
TRIP12 | 0.92 | 0.93 |
CLINT1 | 0.92 | 0.92 |
ZC3H14 | 0.92 | 0.91 |
PIK3C3 | 0.92 | 0.93 |
TBC1D23 | 0.91 | 0.92 |
YME1L1 | 0.91 | 0.91 |
NUP133 | 0.91 | 0.91 |
APPBP2 | 0.91 | 0.93 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.76 | -0.74 |
MT-CO2 | -0.75 | -0.76 |
FXYD1 | -0.73 | -0.74 |
AF347015.31 | -0.73 | -0.75 |
IFI27 | -0.72 | -0.74 |
AF347015.8 | -0.72 | -0.74 |
AF347015.33 | -0.72 | -0.73 |
AF347015.27 | -0.70 | -0.73 |
HIGD1B | -0.70 | -0.72 |
MT-CYB | -0.69 | -0.71 |
Section III. Gene Ontology annotation
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
GO:0016020 | membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 9760194 | |
GO:0030054 | cell junction | IEA | - | |
GO:0042470 | melanosome | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA DN | 349 | 157 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
DOANE RESPONSE TO ANDROGEN UP | 184 | 125 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
MARKEY RB1 CHRONIC LOF DN | 118 | 78 | All SZGR 2.0 genes in this pathway |
GARCIA TARGETS OF FLI1 AND DAX1 UP | 57 | 34 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS DN | 411 | 249 | All SZGR 2.0 genes in this pathway |
GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
ROSS ACUTE MYELOID LEUKEMIA CBF | 82 | 57 | All SZGR 2.0 genes in this pathway |
SHEPARD BMYB MORPHOLINO DN | 200 | 112 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
ALCALAY AML BY NPM1 LOCALIZATION DN | 184 | 132 | All SZGR 2.0 genes in this pathway |
MOREAUX MULTIPLE MYELOMA BY TACI UP | 412 | 249 | All SZGR 2.0 genes in this pathway |
VERHAAK AML WITH NPM1 MUTATED DN | 246 | 180 | All SZGR 2.0 genes in this pathway |
MCCLUNG DELTA FOSB TARGETS 8WK | 47 | 38 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY E2F4 UNSTIMULATED | 728 | 415 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS UP | 388 | 234 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL B DN | 564 | 326 | All SZGR 2.0 genes in this pathway |
GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER ESR1 UP | 167 | 99 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS DN | 442 | 275 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA MF DN | 41 | 28 | All SZGR 2.0 genes in this pathway |
DANG REGULATED BY MYC UP | 72 | 53 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL DN | 428 | 246 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-218 | 2844 | 2851 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-224 | 3618 | 3624 | m8 | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
miR-34b | 3384 | 3390 | m8 | hsa-miR-34b | UAGGCAGUGUCAUUAGCUGAUUG |
miR-485-5p | 97 | 103 | m8 | hsa-miR-485-5p | AGAGGCUGGCCGUGAUGAAUUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.