Gene Page: ARHGEF2
Summary ?
GeneID | 9181 |
Symbol | ARHGEF2 |
Synonyms | GEF|GEF-H1|GEFH1|LFP40|P40 |
Description | Rho/Rac guanine nucleotide exchange factor 2 |
Reference | MIM:607560|HGNC:HGNC:682|Ensembl:ENSG00000116584|HPRD:10458|Vega:OTTHUMG00000017464 |
Gene type | protein-coding |
Map location | 1q21-q22 |
Sherlock p-value | 0.847 |
Fetal beta | -0.22 |
DMG | 1 (# studies) |
eGene | Meta |
Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg18154114 | 1 | 155948831 | ARHGEF2 | 1.387E-4 | -0.337 | 0.031 | DMG:Wockner_2014 |
cg11216632 | 1 | 155944655 | ARHGEF2 | 2.856E-4 | -0.519 | 0.039 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
XRN2 | 0.94 | 0.92 |
SLC39A6 | 0.94 | 0.89 |
PGD | 0.94 | 0.91 |
GPN1 | 0.93 | 0.93 |
KHDRBS1 | 0.93 | 0.91 |
FUBP1 | 0.93 | 0.92 |
C2orf44 | 0.93 | 0.92 |
KDM1 | 0.93 | 0.93 |
NARS2 | 0.93 | 0.94 |
BZW2 | 0.93 | 0.96 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
HLA-F | -0.73 | -0.84 |
AIFM3 | -0.72 | -0.82 |
FBXO2 | -0.72 | -0.73 |
C5orf53 | -0.71 | -0.73 |
HEPN1 | -0.70 | -0.83 |
ALDOC | -0.70 | -0.76 |
AF347015.27 | -0.70 | -0.92 |
TSC22D4 | -0.70 | -0.82 |
CLU | -0.70 | -0.77 |
S100B | -0.69 | -0.84 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005089 | Rho guanyl-nucleotide exchange factor activity | IEA | - | |
GO:0005085 | guanyl-nucleotide exchange factor activity | TAS | 9857026 | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0008017 | microtubule binding | ISS | - | |
GO:0019992 | diacylglycerol binding | IEA | - | |
GO:0048365 | Rac GTPase binding | ISS | - | |
GO:0030676 | Rac guanyl-nucleotide exchange factor activity | ISS | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000902 | cell morphogenesis | ISS | - | |
GO:0007242 | intracellular signaling cascade | IEA | - | |
GO:0007026 | negative regulation of microtubule depolymerization | ISS | - | |
GO:0007166 | cell surface receptor linked signal transduction | TAS | 9857026 | |
GO:0007049 | cell cycle | IEA | - | |
GO:0007067 | mitosis | IEA | - | |
GO:0007015 | actin filament organization | ISS | - | |
GO:0035023 | regulation of Rho protein signal transduction | IEA | - | |
GO:0051301 | cell division | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005923 | tight junction | IEA | Brain (GO term level: 10) | - |
GO:0005794 | Golgi apparatus | IEA | - | |
GO:0005819 | spindle | IEA | - | |
GO:0005874 | microtubule | ISS | - | |
GO:0005622 | intracellular | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0030054 | cell junction | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
CGN | DKFZp779N1112 | FLJ39281 | KIAA1319 | cingulin | ARHGEF2 (GEF-H1) interacts with CGN (Cingulin). This interaction was modeled on a demonstrated interaction between canine GEF-H1 and canine and human Cingulin. | BIND | 15866167 |
MYC | bHLHe39 | c-Myc | v-myc myelocytomatosis viral oncogene homolog (avian) | Affinity Capture-MS | BioGRID | 17353931 |
NFKBIE | IKBE | nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon | - | HPRD | 14743216 |
PAK1 | MGC130000 | MGC130001 | PAKalpha | p21 protein (Cdc42/Rac)-activated kinase 1 | Affinity Capture-MS Reconstituted Complex | BioGRID | 14970201 |
RAC1 | MGC111543 | MIG5 | TC-25 | p21-Rac1 | ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) | - | HPRD,BioGRID | 9857026 |11595749 |
RHOA | ARH12 | ARHA | RHO12 | RHOH12 | ras homolog gene family, member A | - | HPRD,BioGRID | 9857026 |
RRAS2 | TC21 | related RAS viral (r-ras) oncogene homolog 2 | - | HPRD | 12384139 |
WASF1 | FLJ31482 | KIAA0269 | SCAR1 | WAVE | WAVE1 | WAS protein family, member 1 | Affinity Capture-Western | BioGRID | 9843499 |
YWHAE | 14-3-3E | FLJ45465 | KCIP-1 | MDCR | MDS | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide | - | HPRD | 14970201 |
YWHAG | 14-3-3GAMMA | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide | - | HPRD | 15324660 |
YWHAQ | 14-3-3 | 1C5 | HS1 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide | Affinity Capture-Western | BioGRID | 14970201 |
YWHAZ | KCIP-1 | MGC111427 | MGC126532 | MGC138156 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide | - | HPRD | 14970201 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG PATHOGENIC ESCHERICHIA COLI INFECTION | 59 | 36 | All SZGR 2.0 genes in this pathway |
BIOCARTA PTDINS PATHWAY | 23 | 16 | All SZGR 2.0 genes in this pathway |
BIOCARTA MYOSIN PATHWAY | 31 | 22 | All SZGR 2.0 genes in this pathway |
BIOCARTA PAR1 PATHWAY | 37 | 28 | All SZGR 2.0 genes in this pathway |
PID RHOA REG PATHWAY | 46 | 30 | All SZGR 2.0 genes in this pathway |
PID REELIN PATHWAY | 29 | 29 | All SZGR 2.0 genes in this pathway |
PID RAC1 REG PATHWAY | 38 | 25 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY RHO GTPASES | 113 | 81 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
REACTOME NRAGE SIGNALS DEATH THROUGH JNK | 43 | 33 | All SZGR 2.0 genes in this pathway |
REACTOME CELL DEATH SIGNALLING VIA NRAGE NRIF AND NADE | 60 | 43 | All SZGR 2.0 genes in this pathway |
REACTOME P75 NTR RECEPTOR MEDIATED SIGNALLING | 81 | 61 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA1213 SIGNALLING EVENTS | 74 | 56 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
OSMAN BLADDER CANCER DN | 406 | 230 | All SZGR 2.0 genes in this pathway |
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN | 335 | 193 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR DN | 214 | 133 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 DN | 153 | 100 | All SZGR 2.0 genes in this pathway |
CONCANNON APOPTOSIS BY EPOXOMICIN UP | 239 | 157 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 5 6WK DN | 137 | 97 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 6 7WK UP | 197 | 135 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE UP | 134 | 93 | All SZGR 2.0 genes in this pathway |
AMUNDSON GENOTOXIC SIGNATURE | 105 | 68 | All SZGR 2.0 genes in this pathway |
GRUETZMANN PANCREATIC CANCER UP | 358 | 245 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 480 HELA | 164 | 118 | All SZGR 2.0 genes in this pathway |
ASTON MAJOR DEPRESSIVE DISORDER DN | 160 | 110 | All SZGR 2.0 genes in this pathway |
XU CREBBP TARGETS DN | 44 | 31 | All SZGR 2.0 genes in this pathway |
BASSO CD40 SIGNALING UP | 101 | 76 | All SZGR 2.0 genes in this pathway |
MCCLUNG DELTA FOSB TARGETS 8WK | 47 | 38 | All SZGR 2.0 genes in this pathway |
MARIADASON RESPONSE TO CURCUMIN SULINDAC 7 | 19 | 10 | All SZGR 2.0 genes in this pathway |
WANG CISPLATIN RESPONSE AND XPC DN | 228 | 146 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 6HR DN | 160 | 101 | All SZGR 2.0 genes in this pathway |
MARTINEZ RESPONSE TO TRABECTEDIN DN | 271 | 175 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB UP | 245 | 159 | All SZGR 2.0 genes in this pathway |
FIRESTEIN PROLIFERATION | 175 | 125 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS 36HR UP | 221 | 150 | All SZGR 2.0 genes in this pathway |
CROONQUIST NRAS VS STROMAL STIMULATION UP | 41 | 26 | All SZGR 2.0 genes in this pathway |
WOO LIVER CANCER RECURRENCE UP | 105 | 75 | All SZGR 2.0 genes in this pathway |
MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
HIRSCH CELLULAR TRANSFORMATION SIGNATURE UP | 242 | 159 | All SZGR 2.0 genes in this pathway |
CHYLA CBFA2T3 TARGETS UP | 387 | 225 | All SZGR 2.0 genes in this pathway |
ACOSTA PROLIFERATION INDEPENDENT MYC TARGETS DN | 116 | 74 | All SZGR 2.0 genes in this pathway |
KASLER HDAC7 TARGETS 1 UP | 194 | 133 | All SZGR 2.0 genes in this pathway |
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP | 271 | 165 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
PECE MAMMARY STEM CELL DN | 146 | 88 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-133 | 658 | 664 | m8 | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
miR-135 | 324 | 331 | 1A,m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-24* | 739 | 746 | 1A,m8 | hsa-miR-189 | GUGCCUACUGAGCUGAUAUCAGU |
miR-384 | 247 | 253 | 1A | hsa-miR-384 | AUUCCUAGAAAUUGUUCAUA |
miR-543 | 665 | 671 | m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
miR-9 | 699 | 705 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.