Gene Page: ARHGEF2
Summary ?
| GeneID | 9181 |
| Symbol | ARHGEF2 |
| Synonyms | GEF|GEF-H1|GEFH1|LFP40|P40 |
| Description | Rho/Rac guanine nucleotide exchange factor 2 |
| Reference | MIM:607560|HGNC:HGNC:682|Ensembl:ENSG00000116584|HPRD:10458|Vega:OTTHUMG00000017464 |
| Gene type | protein-coding |
| Map location | 1q21-q22 |
| Sherlock p-value | 0.847 |
| Fetal beta | -0.22 |
| DMG | 1 (# studies) |
| eGene | Meta |
| Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg18154114 | 1 | 155948831 | ARHGEF2 | 1.387E-4 | -0.337 | 0.031 | DMG:Wockner_2014 |
| cg11216632 | 1 | 155944655 | ARHGEF2 | 2.856E-4 | -0.519 | 0.039 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| XRN2 | 0.94 | 0.92 |
| SLC39A6 | 0.94 | 0.89 |
| PGD | 0.94 | 0.91 |
| GPN1 | 0.93 | 0.93 |
| KHDRBS1 | 0.93 | 0.91 |
| FUBP1 | 0.93 | 0.92 |
| C2orf44 | 0.93 | 0.92 |
| KDM1 | 0.93 | 0.93 |
| NARS2 | 0.93 | 0.94 |
| BZW2 | 0.93 | 0.96 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| HLA-F | -0.73 | -0.84 |
| AIFM3 | -0.72 | -0.82 |
| FBXO2 | -0.72 | -0.73 |
| C5orf53 | -0.71 | -0.73 |
| HEPN1 | -0.70 | -0.83 |
| ALDOC | -0.70 | -0.76 |
| AF347015.27 | -0.70 | -0.92 |
| TSC22D4 | -0.70 | -0.82 |
| CLU | -0.70 | -0.77 |
| S100B | -0.69 | -0.84 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005089 | Rho guanyl-nucleotide exchange factor activity | IEA | - | |
| GO:0005085 | guanyl-nucleotide exchange factor activity | TAS | 9857026 | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0008017 | microtubule binding | ISS | - | |
| GO:0019992 | diacylglycerol binding | IEA | - | |
| GO:0048365 | Rac GTPase binding | ISS | - | |
| GO:0030676 | Rac guanyl-nucleotide exchange factor activity | ISS | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000902 | cell morphogenesis | ISS | - | |
| GO:0007242 | intracellular signaling cascade | IEA | - | |
| GO:0007026 | negative regulation of microtubule depolymerization | ISS | - | |
| GO:0007166 | cell surface receptor linked signal transduction | TAS | 9857026 | |
| GO:0007049 | cell cycle | IEA | - | |
| GO:0007067 | mitosis | IEA | - | |
| GO:0007015 | actin filament organization | ISS | - | |
| GO:0035023 | regulation of Rho protein signal transduction | IEA | - | |
| GO:0051301 | cell division | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005923 | tight junction | IEA | Brain (GO term level: 10) | - |
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0005819 | spindle | IEA | - | |
| GO:0005874 | microtubule | ISS | - | |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0030054 | cell junction | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| CGN | DKFZp779N1112 | FLJ39281 | KIAA1319 | cingulin | ARHGEF2 (GEF-H1) interacts with CGN (Cingulin). This interaction was modeled on a demonstrated interaction between canine GEF-H1 and canine and human Cingulin. | BIND | 15866167 |
| MYC | bHLHe39 | c-Myc | v-myc myelocytomatosis viral oncogene homolog (avian) | Affinity Capture-MS | BioGRID | 17353931 |
| NFKBIE | IKBE | nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon | - | HPRD | 14743216 |
| PAK1 | MGC130000 | MGC130001 | PAKalpha | p21 protein (Cdc42/Rac)-activated kinase 1 | Affinity Capture-MS Reconstituted Complex | BioGRID | 14970201 |
| RAC1 | MGC111543 | MIG5 | TC-25 | p21-Rac1 | ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) | - | HPRD,BioGRID | 9857026 |11595749 |
| RHOA | ARH12 | ARHA | RHO12 | RHOH12 | ras homolog gene family, member A | - | HPRD,BioGRID | 9857026 |
| RRAS2 | TC21 | related RAS viral (r-ras) oncogene homolog 2 | - | HPRD | 12384139 |
| WASF1 | FLJ31482 | KIAA0269 | SCAR1 | WAVE | WAVE1 | WAS protein family, member 1 | Affinity Capture-Western | BioGRID | 9843499 |
| YWHAE | 14-3-3E | FLJ45465 | KCIP-1 | MDCR | MDS | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide | - | HPRD | 14970201 |
| YWHAG | 14-3-3GAMMA | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide | - | HPRD | 15324660 |
| YWHAQ | 14-3-3 | 1C5 | HS1 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide | Affinity Capture-Western | BioGRID | 14970201 |
| YWHAZ | KCIP-1 | MGC111427 | MGC126532 | MGC138156 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide | - | HPRD | 14970201 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG PATHOGENIC ESCHERICHIA COLI INFECTION | 59 | 36 | All SZGR 2.0 genes in this pathway |
| BIOCARTA PTDINS PATHWAY | 23 | 16 | All SZGR 2.0 genes in this pathway |
| BIOCARTA MYOSIN PATHWAY | 31 | 22 | All SZGR 2.0 genes in this pathway |
| BIOCARTA PAR1 PATHWAY | 37 | 28 | All SZGR 2.0 genes in this pathway |
| PID RHOA REG PATHWAY | 46 | 30 | All SZGR 2.0 genes in this pathway |
| PID REELIN PATHWAY | 29 | 29 | All SZGR 2.0 genes in this pathway |
| PID RAC1 REG PATHWAY | 38 | 25 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY RHO GTPASES | 113 | 81 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
| REACTOME NRAGE SIGNALS DEATH THROUGH JNK | 43 | 33 | All SZGR 2.0 genes in this pathway |
| REACTOME CELL DEATH SIGNALLING VIA NRAGE NRIF AND NADE | 60 | 43 | All SZGR 2.0 genes in this pathway |
| REACTOME P75 NTR RECEPTOR MEDIATED SIGNALLING | 81 | 61 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
| REACTOME G ALPHA1213 SIGNALLING EVENTS | 74 | 56 | All SZGR 2.0 genes in this pathway |
| REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
| DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
| OSMAN BLADDER CANCER DN | 406 | 230 | All SZGR 2.0 genes in this pathway |
| GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN | 335 | 193 | All SZGR 2.0 genes in this pathway |
| TIEN INTESTINE PROBIOTICS 24HR DN | 214 | 133 | All SZGR 2.0 genes in this pathway |
| CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 DN | 153 | 100 | All SZGR 2.0 genes in this pathway |
| CONCANNON APOPTOSIS BY EPOXOMICIN UP | 239 | 157 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL BREAST 5 6WK DN | 137 | 97 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL BREAST 6 7WK UP | 197 | 135 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE UP | 134 | 93 | All SZGR 2.0 genes in this pathway |
| AMUNDSON GENOTOXIC SIGNATURE | 105 | 68 | All SZGR 2.0 genes in this pathway |
| GRUETZMANN PANCREATIC CANCER UP | 358 | 245 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
| AMIT EGF RESPONSE 480 HELA | 164 | 118 | All SZGR 2.0 genes in this pathway |
| ASTON MAJOR DEPRESSIVE DISORDER DN | 160 | 110 | All SZGR 2.0 genes in this pathway |
| XU CREBBP TARGETS DN | 44 | 31 | All SZGR 2.0 genes in this pathway |
| BASSO CD40 SIGNALING UP | 101 | 76 | All SZGR 2.0 genes in this pathway |
| MCCLUNG DELTA FOSB TARGETS 8WK | 47 | 38 | All SZGR 2.0 genes in this pathway |
| MARIADASON RESPONSE TO CURCUMIN SULINDAC 7 | 19 | 10 | All SZGR 2.0 genes in this pathway |
| WANG CISPLATIN RESPONSE AND XPC DN | 228 | 146 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
| JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 6HR DN | 160 | 101 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RESPONSE TO TRABECTEDIN DN | 271 | 175 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
| IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
| BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
| BLUM RESPONSE TO SALIRASIB UP | 245 | 159 | All SZGR 2.0 genes in this pathway |
| FIRESTEIN PROLIFERATION | 175 | 125 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS 36HR UP | 221 | 150 | All SZGR 2.0 genes in this pathway |
| CROONQUIST NRAS VS STROMAL STIMULATION UP | 41 | 26 | All SZGR 2.0 genes in this pathway |
| WOO LIVER CANCER RECURRENCE UP | 105 | 75 | All SZGR 2.0 genes in this pathway |
| MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
| KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
| HIRSCH CELLULAR TRANSFORMATION SIGNATURE UP | 242 | 159 | All SZGR 2.0 genes in this pathway |
| CHYLA CBFA2T3 TARGETS UP | 387 | 225 | All SZGR 2.0 genes in this pathway |
| ACOSTA PROLIFERATION INDEPENDENT MYC TARGETS DN | 116 | 74 | All SZGR 2.0 genes in this pathway |
| KASLER HDAC7 TARGETS 1 UP | 194 | 133 | All SZGR 2.0 genes in this pathway |
| TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP | 271 | 165 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
| PECE MAMMARY STEM CELL DN | 146 | 88 | All SZGR 2.0 genes in this pathway |
| ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-133 | 658 | 664 | m8 | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
| hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
| miR-135 | 324 | 331 | 1A,m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
| hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
| miR-24* | 739 | 746 | 1A,m8 | hsa-miR-189 | GUGCCUACUGAGCUGAUAUCAGU |
| miR-384 | 247 | 253 | 1A | hsa-miR-384 | AUUCCUAGAAAUUGUUCAUA |
| miR-543 | 665 | 671 | m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
| miR-9 | 699 | 705 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.