Gene Page: ATP1A2
Summary ?
| GeneID | 477 |
| Symbol | ATP1A2 |
| Synonyms | FHM2|MHP2 |
| Description | ATPase Na+/K+ transporting subunit alpha 2 |
| Reference | MIM:182340|HGNC:HGNC:800|Ensembl:ENSG00000018625|HPRD:01665|Vega:OTTHUMG00000024080 |
| Gene type | protein-coding |
| Map location | 1q23.2 |
| Sherlock p-value | 0.692 |
| Fetal beta | -1.285 |
| eGene | Myers' cis & trans |
| Support | ION BALANCE G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_mGluR5 G2Cdb.human_Synaptosome CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs13395823 | chr2 | 225743518 | ATP1A2 | 477 | 0.14 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| BTG2 | 0.60 | 0.33 |
| FOS | 0.60 | 0.44 |
| FOXF1 | 0.59 | 0.28 |
| ZFP36 | 0.58 | 0.33 |
| JUNB | 0.57 | 0.40 |
| FOSB | 0.56 | 0.50 |
| GADD45B | 0.54 | 0.35 |
| APOLD1 | 0.54 | 0.25 |
| ZC3H12A | 0.53 | 0.16 |
| PRDM1 | 0.53 | 0.24 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| RP9P | -0.25 | -0.27 |
| AC007216.4 | -0.25 | -0.30 |
| AGAP4 | -0.23 | -0.27 |
| F8A1 | -0.23 | -0.30 |
| KIF21B | -0.23 | -0.19 |
| NKAPL | -0.21 | -0.14 |
| KLHL1 | -0.21 | -0.16 |
| IL32 | -0.21 | -0.18 |
| EIF5B | -0.21 | -0.19 |
| STRA13 | -0.21 | -0.20 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0000287 | magnesium ion binding | IEA | - | |
| GO:0005524 | ATP binding | IC | 12539047 | |
| GO:0005391 | sodium:potassium-exchanging ATPase activity | IMP | 12539047 | |
| GO:0016787 | hydrolase activity | IEA | - | |
| GO:0016820 | hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances | IEA | - | |
| GO:0015077 | monovalent inorganic cation transmembrane transporter activity | IEA | - | |
| GO:0030955 | potassium ion binding | IEA | - | |
| GO:0031402 | sodium ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0008152 | metabolic process | IEA | - | |
| GO:0006814 | sodium ion transport | NAS | 10642400 | |
| GO:0006813 | potassium ion transport | NAS | 10642400 | |
| GO:0006942 | regulation of striated muscle contraction | NAS | 10642400 | |
| GO:0030317 | sperm motility | ISS | - | |
| GO:0030641 | regulation of cellular pH | ISS | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005737 | cytoplasm | IDA | 12539047 | |
| GO:0016021 | integral to membrane | IEA | - | |
| GO:0005886 | plasma membrane | IDA | 12539047 | |
| GO:0005890 | sodium:potassium-exchanging ATPase complex | IC | 12539047 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG CARDIAC MUSCLE CONTRACTION | 80 | 51 | All SZGR 2.0 genes in this pathway |
| KEGG ALDOSTERONE REGULATED SODIUM REABSORPTION | 42 | 29 | All SZGR 2.0 genes in this pathway |
| KEGG PROXIMAL TUBULE BICARBONATE RECLAMATION | 23 | 16 | All SZGR 2.0 genes in this pathway |
| REACTOME TRANSMEMBRANE TRANSPORT OF SMALL MOLECULES | 413 | 270 | All SZGR 2.0 genes in this pathway |
| REACTOME ION TRANSPORT BY P TYPE ATPASES | 34 | 21 | All SZGR 2.0 genes in this pathway |
| REACTOME ION CHANNEL TRANSPORT | 55 | 42 | All SZGR 2.0 genes in this pathway |
| LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
| TURASHVILI BREAST DUCTAL CARCINOMA VS DUCTAL NORMAL DN | 198 | 110 | All SZGR 2.0 genes in this pathway |
| TURASHVILI BREAST DUCTAL CARCINOMA VS LOBULAR NORMAL DN | 69 | 43 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE LIVE DN | 384 | 220 | All SZGR 2.0 genes in this pathway |
| VECCHI GASTRIC CANCER EARLY DN | 367 | 220 | All SZGR 2.0 genes in this pathway |
| LEE NEURAL CREST STEM CELL UP | 146 | 99 | All SZGR 2.0 genes in this pathway |
| SABATES COLORECTAL ADENOMA DN | 291 | 176 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS 8HR UP | 164 | 122 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
| COLIN PILOCYTIC ASTROCYTOMA VS GLIOBLASTOMA UP | 35 | 32 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
| FERNANDEZ BOUND BY MYC | 182 | 116 | All SZGR 2.0 genes in this pathway |
| YAO HOXA10 TARGETS VIA PROGESTERONE UP | 79 | 58 | All SZGR 2.0 genes in this pathway |
| HOEGERKORP CD44 TARGETS DIRECT UP | 27 | 21 | All SZGR 2.0 genes in this pathway |
| MODY HIPPOCAMPUS POSTNATAL | 63 | 50 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| VIETOR IFRD1 TARGETS | 23 | 13 | All SZGR 2.0 genes in this pathway |
| LEE CALORIE RESTRICTION MUSCLE UP | 43 | 33 | All SZGR 2.0 genes in this pathway |
| CUI TCF21 TARGETS 2 UP | 428 | 266 | All SZGR 2.0 genes in this pathway |
| ABE INNER EAR | 48 | 26 | All SZGR 2.0 genes in this pathway |
| HOWLIN CITED1 TARGETS 1 DN | 37 | 22 | All SZGR 2.0 genes in this pathway |
| LEIN ASTROCYTE MARKERS | 42 | 35 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER LUMINAL A UP | 84 | 52 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
| BOQUEST STEM CELL UP | 260 | 174 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
| SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF LCP WITH H3K27ME3 | 70 | 35 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| NAKAYAMA SOFT TISSUE TUMORS PCA2 DN | 80 | 51 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES LCP WITH H3K4ME3 | 142 | 80 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 0 | 76 | 54 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 2HR UP | 39 | 30 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-17-5p/20/93.mr/106/519.d | 2080 | 2087 | 1A,m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
| hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
| hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
| hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
| hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
| hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
| miR-26 | 2218 | 2225 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
| hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.