Gene Page: ADAR
Summary ?
GeneID | 103 |
Symbol | ADAR |
Synonyms | ADAR1|AGS6|DRADA|DSH|DSRAD|G1P1|IFI-4|IFI4|K88DSRBP|P136 |
Description | adenosine deaminase, RNA-specific |
Reference | MIM:146920|HGNC:HGNC:225|Ensembl:ENSG00000160710|HPRD:07528|Vega:OTTHUMG00000037261 |
Gene type | protein-coding |
Map location | 1q21.3 |
Sherlock p-value | 0.388 |
Fetal beta | -0.259 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans Meta |
Support | G2Cdb.humanPSD G2Cdb.humanPSP Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenics,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg01517273 | 1 | 154599968 | ADAR | 6.12E-8 | -0.008 | 1.53E-5 | DMG:Jaffe_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs4854166 | chr2 | 3297005 | ADAR | 103 | 0.18 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003677 | DNA binding | IEA | - | |
GO:0003725 | double-stranded RNA binding | IEA | - | |
GO:0003726 | double-stranded RNA adenosine deaminase activity | NAS | 7565688 | |
GO:0016787 | hydrolase activity | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006397 | mRNA processing | IEA | - | |
GO:0031047 | gene silencing by RNA | IEA | - | |
GO:0016553 | base conversion or substitution editing | IDA | 9020165 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005634 | nucleus | TAS | 7565688 | |
GO:0005730 | nucleolus | IDA | 18029348 | |
GO:0005737 | cytoplasm | TAS | 7565688 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CYTOSOLIC DNA SENSING PATHWAY | 56 | 44 | All SZGR 2.0 genes in this pathway |
REACTOME MRNA PROCESSING | 161 | 86 | All SZGR 2.0 genes in this pathway |
REACTOME INTERFERON ALPHA BETA SIGNALING | 64 | 50 | All SZGR 2.0 genes in this pathway |
REACTOME INTERFERON SIGNALING | 159 | 116 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM | 270 | 204 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN | 126 | 86 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 2 DN | 77 | 46 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 DN | 162 | 116 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
MARKEY RB1 ACUTE LOF UP | 215 | 137 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP | 552 | 347 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION UP | 211 | 136 | All SZGR 2.0 genes in this pathway |
OUELLET OVARIAN CANCER INVASIVE VS LMP UP | 117 | 85 | All SZGR 2.0 genes in this pathway |
EINAV INTERFERON SIGNATURE IN CANCER | 27 | 16 | All SZGR 2.0 genes in this pathway |
MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
LOCKWOOD AMPLIFIED IN LUNG CANCER | 214 | 139 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
BYSTROEM CORRELATED WITH IL5 DN | 64 | 47 | All SZGR 2.0 genes in this pathway |
GRANDVAUX IFN RESPONSE NOT VIA IRF3 | 14 | 10 | All SZGR 2.0 genes in this pathway |
DER IFN ALPHA RESPONSE UP | 74 | 48 | All SZGR 2.0 genes in this pathway |
RADAEVA RESPONSE TO IFNA1 UP | 52 | 40 | All SZGR 2.0 genes in this pathway |
DER IFN BETA RESPONSE UP | 102 | 67 | All SZGR 2.0 genes in this pathway |
DER IFN GAMMA RESPONSE UP | 71 | 45 | All SZGR 2.0 genes in this pathway |
NEMETH INFLAMMATORY RESPONSE LPS UP | 88 | 64 | All SZGR 2.0 genes in this pathway |
XU CREBBP TARGETS DN | 44 | 31 | All SZGR 2.0 genes in this pathway |
KUMAR TARGETS OF MLL AF9 FUSION | 405 | 264 | All SZGR 2.0 genes in this pathway |
MCCLUNG DELTA FOSB TARGETS 8WK | 47 | 38 | All SZGR 2.0 genes in this pathway |
SCHLINGEMANN SKIN CARCINOGENESIS TPA UP | 42 | 24 | All SZGR 2.0 genes in this pathway |
VISALA RESPONSE TO HEAT SHOCK AND AGING UP | 15 | 10 | All SZGR 2.0 genes in this pathway |
GEISS RESPONSE TO DSRNA UP | 38 | 29 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 2D UP | 69 | 46 | All SZGR 2.0 genes in this pathway |
GRADE METASTASIS DN | 45 | 31 | All SZGR 2.0 genes in this pathway |
GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
ISHIKAWA STING SIGNALING | 8 | 6 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G1 UP | 113 | 70 | All SZGR 2.0 genes in this pathway |
KYNG WERNER SYNDROM AND NORMAL AGING DN | 225 | 124 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 2703 | 2709 | m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.