SZGR2

Summary ?

GeneID	11057
Symbol	ABHD2
Synonyms	HS1-2\|LABH2\|PHPS1-2
Description	abhydrolase domain containing 2
Reference	MIM:612196\|HGNC:HGNC:18717\|Ensembl:ENSG00000140526\|HPRD:09791\|Vega:OTTHUMG00000148684
Gene type	protein-coding
Map location	15q26.1
Pascal p-value	0.007

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
Expression	Meta-analysis of gene expression	P value: 2.052

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PALM2-AKAP2	0.97	0.98
PHACTR2	0.87	0.76
PLCB4	0.85	0.74
AHNAK2	0.85	0.78
PAQR9	0.84	0.79
PTPN4	0.84	0.75
RASSF3	0.84	0.64
KCNH5	0.82	0.71
STS	0.82	0.80
RORA	0.82	0.56

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C1orf61	-0.40	-0.61
C2orf84	-0.39	-0.45
SAT1	-0.37	-0.51
AF347015.21	-0.37	-0.49
C1orf54	-0.36	-0.54
S100A13	-0.36	-0.46
SYCP3	-0.35	-0.50
C8orf59	-0.35	-0.42
CBR3	-0.35	-0.46
FXYD1	-0.35	-0.43

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003674	molecular_function	ND		-
GO:0004091	carboxylesterase activity	IEA		-
GO:0016787	hydrolase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0009611	response to wounding	IEA		-
GO:0008150	biological_process	ND		-
GO:0030336	negative regulation of cell migration	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IDA		18029348
GO:0005730	nucleolus	IDA		18029348
GO:0005737	cytoplasm	IDA		18029348
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	NAS		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP	285	181	All SZGR 2.0 genes in this pathway
ZHONG RESPONSE TO AZACITIDINE AND TSA UP	183	119	All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP	579	346	All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA UP	368	234	All SZGR 2.0 genes in this pathway
JAEGER METASTASIS DN	258	141	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP	380	236	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP	418	263	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 UP	341	197	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 UP	137	84	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
WANG BARRETTS ESOPHAGUS UP	51	27	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS LUMINAL	326	213	All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS DN	193	112	All SZGR 2.0 genes in this pathway
JAZAG TGFB1 SIGNALING UP	108	69	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 480 HELA	164	118	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER ACOX1 UP	64	40	All SZGR 2.0 genes in this pathway
NELSON RESPONSE TO ANDROGEN UP	86	61	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER CIPROFIBRATE UP	60	42	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER DENA UP	60	40	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD1 AND CD2 DN	51	32	All SZGR 2.0 genes in this pathway
VERHAAK AML WITH NPM1 MUTATED UP	183	111	All SZGR 2.0 genes in this pathway
HENDRICKS SMARCA4 TARGETS UP	56	35	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 24HR UP	148	96	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
YEGNASUBRAMANIAN PROSTATE CANCER	128	60	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR DN	191	123	All SZGR 2.0 genes in this pathway
TOYOTA TARGETS OF MIR34B AND MIR34C	463	262	All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G1 DN	40	26	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S3	266	180	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA DN	267	160	All SZGR 2.0 genes in this pathway
MARTENS BOUND BY PML RARA FUSION	456	287	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR UP	229	149	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR UP	324	193	All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN	229	135	All SZGR 2.0 genes in this pathway
PASINI SUZ12 TARGETS DN	315	215	All SZGR 2.0 genes in this pathway
SUMI HNF4A TARGETS	34	14	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP	682	433	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	6553	6559	m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-129-5p	6079	6085	m8	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	6079	6085	m8	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-134	6154	6161	1A,m8	hsa-miR-134^brain	UGUGACUGGUUGACCAGAGGG
miR-143	5801	5807	m8	hsa-miR-143^brain	UGAGAUGAAGCACUGUAGCUCA
miR-17-5p/20/93.mr/106/519.d	1946	1953	1A,m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
				hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-186	5083	5090	1A,m8	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-205	5736	5742	1A	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-214	4480	4486	m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-219	1762	1769	1A,m8	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-24	5786	5792	m8	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG
miR-26	1450	1457	1A,m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	1450	1457	1A,m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-27	6289	6295	1A	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	6289	6295	1A	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-30-5p	6102	6108	m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-326	4117	4123	1A	hsa-miR-326	CCUCUGGGCCCUUCCUCCAG
miR-33	6724	6731	1A,m8	hsa-miR-33	GUGCAUUGUAGUUGCAUUG
miR-33	6724	6731	1A,m8	hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
miR-330	332	338	m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-450	6079	6085	1A	hsa-miR-450	UUUUUGCGAUGUGUUCCUAAUA
miR-485-5p	626	632	m8	hsa-miR-485-5p	AGAGGCUGGCCGUGAUGAAUUC
miR-488	3987	3993	1A	hsa-miR-488	CCCAGAUAAUGGCACUCUCAA
miR-494	62	68	1A	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU
miR-495	5168	5174	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-539	5840	5846	m8	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ABHD2